BOLD - the Art of DNA Barcoding

Whitewashed - Thuja plicata

Thuja plicata
van pelt images

Images courtesy of Dr. Robert Van Pelt

A note from Joseph Rossano:

As a child, I felt my greatest sense of security with the world and my place in it when surrounded by trees.  Memories of following my father or uncle as he glided through forests of New York’s Catskill Mountains still evoke the sense of security I felt forty years ago.

Much of my work has explored species dependent on forests, including butterflies, the Marbled Murrelet and the Ivory-billed Woodpecker.  My sculpture “Whitewashed” does not depict a forest dweller, but instead, a creature synonymous with the ice flows of the great white north, the polar bear.  Still, “Whitewashed” is all about the forest.  The sculpture is fabricated entirely from one large round of salvaged ancient western red cedar.  Like the reality of global warming, the sculpture has been white washed to evoke something else, the white ice fields and bears of the Arctic.  I have used one endangered species to evoke another.

So, what is the reality?  The sculpture is about irony, the irony that comes with knowing that deforestation, the same deforestation which brought you this log, your home, the fuel of progress, renders the earth’s atmosphere ineffective in preventing the build-up of greenhouse gasses.  Quite simply, the planet heats up and the bears go away.

It took over 600 years for the earth to produce the log from which I created “Whitewashed” and another 200 hours for me to create the sculpture, how long will it take man to understand the interconnectedness of his species and all others?

About Thuja plicata - by Dr. Robert Van Pelt

Probably more than any other species, western red cedar (Thuja plicata) typifies the Pacific Northwest coastal forest environment.  This region, known for its giant trees, is the wettest place in North America.  The associated forests are the darkest, densest, and dankest forest imaginable.  Drenched by ten to twenty feet of rain per year, laced by raging torrents or broken up by fragmented swamps filled with icy muck, filled with downed wood and a dense understory of tough, thick, often thorny shrubs, these forests are no friend to the casual hiker or recreationalist, and have generally been explored only immediately before being logged.  Bushwhacking takes on a new dimension on the west coast of Vancouver Island.  Dense salal and huckleberries up to 30 ft tall block your way.  Every surface is covered with moss.  Giant logs, like some nightmarish tinkertoys, are strewn about with abandon.  These remote forest denizens are literally shrouded in mystery.  It is the home of Bigfoot and ghost bears and other creatures that might find their homes only in a forest ten thousand years old.  Fire is a stranger in these landscapes and through thousands of years without it, the cedars have grown older and more numerous until they have come to dominate vast expanses of wet, swampy lowlands and valley bottoms. 

While often associated with swamps or other poorly drained soils, western red cedars can occur on well-drained or even dry environments.  A member of the cypress family, cedars have small cones a close, scale-like foliage (top image, above).  It is one of the world’s oldest trees – lifespans of up to 2000 years are possible in part due to its highly decay-resistant wood.  The wood is decay-resistant and can support even small areas of living crown.  Red cedar crowns are very sensitive to drought – the tops will often die back in a hot, dry year.  A new leader will then develop from a live twig lower in the crown.  This process, repeated over time, creates dozens of tops, most of which are dead.  The illustration of the Stoltmann Cedar (lower right image, above) is a classic example of this.

Western red cedars were the most important tree to the Northwest Coast Indians, who used the wood as a raw material to make canoes, houses, boxes, and a host of other useful items.  The bark and roots were woven into clothes, bowls, baskets, and many household items.  Totem poles, which characterize the Northwest Coast Indians, were made from western red cedar.  After the arrival of Western Europeans in the Pacific Northwest during the 19th century, old-growth wood of western red cedar was found to be highly valuable to them as well (lower middle image, above).  Shingles and shakes were easily split from red cedar wood and this became a thriving industry for much of the past 130 years.  The rapid depletion of old-growth red cedar has the industries based on cedar high and dry.  The second-growth cedar that has grown up in the aftermath of logging does not have the desirable wood qualities of the old-growth wood, so we will have to wait another century or so to have this great wood resource again.

The largest red cedars are found on the western Olympic Peninsula and on the west coast of Vancouver Island.  Even after more than a century of exploitation, these areas have vast (albeit dwindling) unexplored areas of cedar forest such as in the Clayoquot Sound and neighboring areas.  True, where millions of hectare of old-growth forests once covered the landscape, only a few hundred thousand hectares remain.  However, the remaining forests are usually very rugged and impenetrable.  The result is that places like Pacific Rim National Park, the Carmanah and Walbran Valley Provincial Parks, and plenty of as-yet-unprotected areas, are packed with huge cedars in unexplored tracts of forest.  The Cheewhat Lake Cedar (lower right image, above), the largest known tree in Canada, was not discovered until 1988. 

About this piece – Whitewashed by Joseph Rossano

The sculpture is created from one 6ft tall by 8+ ft round of old growth Thuja plicata - western red cedar.  The wood was split by hand and partially painted white to resemble a fracturing ice shelf.  The polar bears sitting atop three of the nine bergs are carved from the same log.  The piece’s title and construction both literally and figuratively point to the issue of global warming.  With the sculpture I hope to direct the viewer to the link between deforestation, global warming, and the plight of the polar bear.

Also, if you look closely at the wall, near the triptych Half a League, you’ll see two series of A’s, C’s, G’s and T’s.  They each make up a DNA sequence, but not just any sequence – each is a sequence unique to a species; one is unique to Ursus maritimus, the other to Thuja plicata.  Each and every species has a different sequence at this particular spot in their DNA code.  Scientists call this sequence fragment a “DNA barcode”.  If each part of the sequence were represented by a different colour, it might look like:

DNA barcode schematic

What is a DNA barcode?

DNA barcoding uses a small fragment of a single gene in an organism’s DNA to identify the species to which that organism belongs, much like one might use a UPC barcode to distinguish different products.  These powerful tools are helping scientists to catalogue the world’s biodiversity.  The process began in Guelph, Ontario, Canada, and scientists here – like collaborator Dr. Paul Hebert of the Biodiversity Institute of Ontario (see below) – continue to lead international work aiming to catalogue the earth’s life forms completely.

More information:

DNA barcode of Thuja plicata

rbcL_Thuja_plicata_AY237154-aagtgtcggattcaaagcgggtgttaaagattacagattaacttattatactccggagtatcagaccaaagata
ctgatatcttggcagcattccgagtcactcctcaacctggagtgccccccgaagaagcgggagcagcagtagctgccgaatcttccactggtacgtggaccactg
tttggaccgatggacttaccagtcttgatcgctacaaggggcgatgctatgatattgaacccgttcctggagaggaaaatcaatttattgcctatgtagcttaccct
ttagatctttttgaagaaggctctgtgactaacctgtttacttctattgtaggtaatgtatttggattcaaagctttacgggctctacgtctggaagatttacgaattcc
tcctgcttattcaaaaacttttcaaggcccaccacatggtattcaagtagaaagagataaattaaacaaatatggtcgtcctttgttgggatgtactataaaacca
aaattgggtctatctgccaagaattatggtagagcggtttatgaatgtctc

Barcode courtesy of the International Barcode of Life (iBOL) project.

About the collaborators

Paul Hebert, PhD, a globally recognized pioneer of DNA Barcoding, is Canada Research Chair of Molecular Biodiversity and Director of the Canadian Centre for DNA Barcoding at the Biodiversity Institute, University of Guelph, Ontario, Canada.  He is also Principal Investigator on the International Barcode of Life (iBOL) project.  Click here for more information about Dr. Hebert's work.

Dan Janzen, PhD, is an evolutionary ecologist, naturalist, and conservationist, and Dimaura Professor of Conservation Biology at the University of Pennsylvania.  For 56 years he has spent much of his time doing field research in Costa Rica and since 1985 has been a founder and technical advisor to Area de ConservaciĂłn Guanacaste (ACG).  ACG, 2% of Costa Rica and the size of New York City and all its suburbs, is the oldest, largest and most successful tropical habitat restoration project in the world, located just south of the Costa Rica-Nicaragua border. Click here for more information about Dr. Janzen's efforts.

Ontario Genomics Institute (OGI) is a private, not-for-profit corporation based in Toronto, Ontario, Canada, focused on using world-class research to create strategic genomics resources and accelerate Ontario’s development of a globally-competitive life sciences sector.  Through its relationship with Genome Canada, the Ontario Ministry of Research and Innovation, and other private and public sector partners, OGI works to: identify, attract and support investment in Ontario-led genomics research; catalyze access to and the impact of genomics resources; and, raise the visibility of genomics as well as its impact and associated issues.  Click here to return to our home page and learn more about OGI.

Robert Van Pelt, PhD, is a research Affiliate Professor at the University of Washington in Seattle where he is engaged in canopy research in Douglas Fir and Coast Redwood forests; his main research interests are old-growth ecology, canopy structure and its control of the understory environment, spatial patterns in old-growth forests, and tree plant geography. He spends much of his private life measuring trees – he maintains a database with extensive measurements, sketches and photos of some of the most remarkable trees from around the world. For more information, visit his website.

For more information, click on these links of interest:

The art of Joseph Rossano
•    Joseph Rossano’s official site
•    Bill Lowe Gallery, Atlanta

DNA barcoding
•    Barcode of Life Data Systems
•    Canadian Centre for DNA Barcoding
•    International Barcode of Life (iBOL)