Whitewashed - Ursus maritimus
Image courtesy of the Biodiversity Institute of Ontario
A note from Joseph Rossano:
As a child, I felt my greatest sense of security with the world and my place in it when surrounded by trees. Memories of following my father or uncle as he glided through forests of New York’s Catskill Mountains still evoke the sense of security I felt forty years ago.
Much of my work has explored species dependent on forests, including butterflies, the Marbled Murrelet and the Ivory-billed Woodpecker. My sculpture “Whitewashed” does not depict a forest dweller, but instead, a creature synonymous with the ice flows of the great white north, the polar bear. Still, “Whitewashed” is all about the forest. The sculpture is fabricated entirely from one large round of salvaged ancient western red cedar. Like the reality of global warming, the sculpture has been white washed to evoke something else, the white ice fields and bears of the Arctic. I have used one endangered species to evoke another.
So, what is the reality? The sculpture is about irony, the irony that comes with knowing that deforestation, the same deforestation which brought you this log, your home, the fuel of progress, renders the earth’s atmosphere ineffective in preventing the build-up of greenhouse gasses. Quite simply, the planet heats up and the bears go away.
It took over 600 years for the earth to produce the log from which I created “Whitewashed” and another 200 hours for me to create the sculpture, how long will it take man to understand the interconnectedness of his species and all others?
About Ursus maritimus - by Dr. Paul Hebert
Most bears forage in fields or forests, but Ursus maritimus - the polar bear - is a sea-going bear. Its life is focused on the ice platforms that cover the Arctic Ocean and other northern marine waters. It is a young species, an evolutionary offshoot of the grizzly bear lineage; it arose when our planet shivered to the Big Chill of the Pleistocene no more than a million years ago. Born of a time when much of the northern hemisphere was wrapped in ice, the polar bear remains firmly reliant on cold. It births in ice caves and its newborn cubs soon learn to race across ice surfaces. It hunts on sea ice, particularly targeting the 100 kg ringed seal, the original high energy snack food. When prey is abundant, the polar bear feeds selectively on the brains, eyes and chest muscles of this seal, leaving the balance of each carcass to a retinue of trailing scavengers, ravens and arctic foxes. When times are tough, the polar bear tackles riskier prey - walrus with their sabre-like tusks or even beluga whales which outweigh it by a massive margin.
Born of ice, the polar bear’s future is tied to a planet with frozen extremities. Global warming has already led to a lengthening of the ice-free season in many areas of its range. Ice-free means food deprivation and polar bears in southern regions are loosing weight. At present the species has a massive range, spanning both the Eurasian and North American arctic. However, as global warming provokes the recession of ice platforms, the polar bear will be pushed into retreat. Southern populations will be lost first, but somewhere in the melting arctic, Ursus maritimus will make its last stand in the chilliest realm of a once chillier planet. It is odd to think of life clinging to a polar oasis whose prime resource is cold. But that is where the polar bears will make their last stand. And then the ice will melt; the bears will swim to the next ice, but there will be none. And so it will end; the species that was born of ice will die of fire. Fire and ice, was Robert Frost thinking of Ursus maritimus?
About this piece – Whitewashed by Joseph Rossano
The sculpture is created from one 6ft tall by 8+ ft round of old growth western red cedar. The wood was split by hand and partially painted white to resemble a fracturing ice shelf. The polar bears sitting atop three of the nine bergs are carved from the same log. The piece’s title and construction both literally and figuratively point to the issue of global warming. With the sculpture I hope to direct the viewer to the link between deforestation, global warming, and the plight of the polar bear.
Also, if you look closely at the wall, near the triptych Half a League, you’ll see two series of A’s, C’s, G’s and T’s. They each make up a DNA sequence, but not just any sequence – each is a sequence unique to a species; one is unique to Ursus maritimus, the other to Thuja plicata. Each and every species has a different sequence at this particular spot in their DNA code. Scientists call this sequence fragment a “DNA barcode”. If each part of the sequence were represented by a different colour, it might look like:
What is a DNA barcode?
DNA barcoding uses a small fragment of a single gene in an organism’s DNA to identify the species to which that organism belongs, much like one might use a UPC barcode to distinguish different products. These powerful tools are helping scientists to catalogue the world’s biodiversity. The process began in Guelph, Ontario, Canada, and scientists here – like collaborator Dr. Paul Hebert of the Biodiversity Institute of Ontario (see below) – continue to lead international work aiming to catalogue the earth’s life forms completely.
More information:
- View a video of Dr. Dan Janzen discussing DNA Barcoding.
- Learn about the International Barcode of Life (iBOL) project, an Ontario-led worldwide effort to use DNA barcoding to identify all the species in the world.
DNA barcode of Ursus maritimus
GBMA0108-06|AJ428577|Ursus maritimus|aaccggtgattattctctacgaaccataaagacattggcaccctttatcttctgttcggtgcatga
gccggaatagtgggcactgccctcagccttttaattcgtgccgagctgggtcagcccggggctctgttgggggatgatcagatctacaatgtagtcgtaactgcc
catgcattcgtgataatcttcttcatagttatgcctattataattgggggattcgggaactgattagtgcctttgatgatcggtgcccccgacatagcgttccctcgaa
taaataacataagcttctggttgctgccaccatctttcttactgcttctggcctcctctatggtagaagcaggtgcagggactggatgaactgtctaccctcctctagc
gggtaatctggcccatgcaggagcatcagtagacttaacaatcttttctctgcacctagcaggcatctcttctattctgggggctatcaatttcatcactactattatta
acatgaaaccccctcgaatatctcaatatcaaacccctctgtttgtatgatcagtcctaatcacagcagtacttcttcttttatctctgccagtcttagcagctgggatta
ctatactacttacagatcgaaaccttaacactaccttttttgatccagctggaggaggagatcctattttatatcaacacttgttctgattcttcggacaccctgaggtt
tacattctaatccttcctgggttcggaatgatctctcacattgttacttattattcaggaaaaaaagaaccttttggctatataggaatagtctgagcgataatatcc
attggattcttaggatttatcgtgtgagctcatcatatgtttaccgtaggtatag
Barcode courtesy of the International Barcode of Life (iBOL) project.
About the collaborators
Paul Hebert, PhD, a globally recognized pioneer of DNA Barcoding, is Canada Research Chair of Molecular Biodiversity and Director of the Canadian Centre for DNA Barcoding at the Biodiversity Institute, University of Guelph, Ontario, Canada. He is also Principal Investigator on the International Barcode of Life (iBOL) project. Click here for more information about Dr. Hebert's work.
Dan Janzen, PhD, is an evolutionary ecologist, naturalist, and conservationist, and Dimaura Professor of Conservation Biology at the University of Pennsylvania. For 56 years he has spent much of his time doing field research in Costa Rica and since 1985 has been a founder and technical advisor to Area de ConservaciĂłn Guanacaste (ACG). ACG, 2% of Costa Rica and the size of New York City and all its suburbs, is the oldest, largest and most successful tropical habitat restoration project in the world, located just south of the Costa Rica-Nicaragua border. Click here for more information about Dr. Janzen's efforts.
Ontario Genomics Institute (OGI) is a private, not-for-profit corporation based in Toronto, Ontario, Canada, focused on using world-class research to create strategic genomics resources and accelerate Ontario’s development of a globally-competitive life sciences sector. Through its relationship with Genome Canada, the Ontario Ministry of Research and Innovation, and other private and public sector partners, OGI works to: identify, attract and support investment in Ontario-led genomics research; catalyze access to and the impact of genomics resources; and, raise the visibility of genomics as well as its impact and associated issues. Click here to return to our home page and learn more about OGI.
For more information, click on these links of interest:
The art of Joseph Rossano
• Joseph Rossano’s official site
• Bill Lowe Gallery, Atlanta
DNA barcoding
• Barcode of Life Data Systems
• Canadian Centre for DNA Barcoding
• International Barcode of Life (iBOL)
