BOLD 9 - Bungalotis diophorus

Image courtesy of the Barcode of Life Data Systems
A note from Joseph Rossano:
As an artist, I strive to distill ideas, concepts, and reality into their bare essence. My resulting minimalist sculptures, I hope, convey an emotion, ask a question, or direct the viewer on a path of introspection and investigation, as they explore man's impact on the environment. My series "BOLD" is named for the acronym for the Barcode of Life Data Systems database. The subject of each specimen box is neither real nor is it an accurate representation of the creature it is designed to represent; rather, it is a jeweled representation of reality that draws the viewer in for a closer inspection. What is the story of this specimen? What is the text on the side of the piece? What is a DNA barcode? Read on for answers to these and other questions.
About Bungalotis diophorus - by Daniel H. Janzen
We have never seen an adult Bungalotis diophorus skipper free-flying in Area de Conservación Guanacaste (ACG). But, they surely are there – their biological tracks, otherwise known as eggs, larvae and pupae – are quite common in the ACG rainforest. The immatures are found only on saplings and treelets of Simarouba amara (Simarubaceae) (though they might also rarely use the dry forest Simarouba glauca where it abuts up against the S. amara population). The leaf nests of an early instar are very visible on the S. amara leaflets, which are neatly arranged along the long rachis like the barbs of a feather. This is because the underside of the leaflet is a very light green, in contrast with the dark green upperside, and when the caterpillar folds over a cut-out portion of the leaflet, the underside shows in striking contrast to the upper side. Later instar larger caterpillars instead silk one leaflet lightly down on top of another, rendering the nest almost invisible unless one concentrates on noticing that the leaflets are not as arrayed in such a an orderly manner as normal. This clue may not be used by foraging birds, but it certainly helps the gusanero to find the late instar caterpillars.
Why do we not see the very different appearing male – which strongly resembles the male of Bungalotis astylos – and female B. diophorus adults? We suspect that they fly in the very late afternoon when it is nearly dark, or even at night, though this is less likely because none have been collected at lights, at least to our knowledge. The female, with her bright white spots, is probably very visible to the monochromatically red-brown male even in the low light of evening. If the wing is viewed at a steep angle, many, but not all, of the white spots virtually glow white – like a bicycle rear reflector or a joggers white reflective protective shoes.
Here we identify this butterfly as B. diophorus, but we suspect that it really is an undescribed species. The problem is that it looks very much like B. diophorus from Brazil, a specimen of which is the holotype for the species name. It looks so much like it that almost anyone would identify the ACG species as that. However, the project skipper taxonomist – John M. Burns at the Smithsonian Institution – has found slight differences between the ACG specimens and the Brazilian specimens, so we await a new name for it in the coming years. This example underlines a chronic problem with Central American butterflies – many closely resemble the type specimen collected in South America, and only very close taxonomic scrutiny, and often, substantial further collecting, can determine if there are one or two species under one name.
Data and images about this species in the ACG can be explored in Google Fusion Tables.
Taken from Miller, J. C., Janzen, D. H. and Hallwachs, W. 2007. 100 Butterflies and moths. Harvard University Press, Cambridge, Massachusetts.
About this piece – BOLD 9: Bungalotis diophorus by Joseph Rossano
If you look closely at the side of the encasement on this work of art, you’ll see a series of A’s, C’s, G’s and T’s. They make up a DNA sequence, but not just any sequence – it’s a sequence unique to this species. Each species has a different sequence at this particular spot in their DNA code. Scientists call this sequence fragment a “DNA barcode”. If each part of the sequence were represented by a different colour, it might look like:
What is a DNA barcode?
DNA barcoding uses a small fragment of a single gene in an organism’s DNA to identify the species to which that organism belongs, much like one might use a UPC barcode to distinguish different products. These powerful tools are helping scientists to catalogue the world’s biodiversity. The process began in Guelph, Ontario, Canada, and scientists here – like collaborator Dr. Paul Hebert of the Biodiversity Institute of Ontario (see below) – continue to lead international work aiming to catalogue the earth’s life forms completely.
More information:
- View a video of Dr. Dan Janzen discussing DNA Barcoding.
- Learn more about using DNA barcoding to advance the discovery and identification of butterflies, moths, and skippers (i.e. Lepidoptera).
- Learn about the International Barcode of Life (iBOL) project, an Ontario-led worldwide effort to use DNA barcoding to identify all the species in the world.
DNA barcode of Bungalotis diophorus
MHMXW124-09|08-SRNP-70422|Bungalotis diophorus|COI-5P- accttatattttatttttggtatttgagcaggaataattggaacttc
attaagattactaattcgaactgaattaggaacccctggatctttaattggagatgatcaaatttataatactattgttactgcccatgcttttattataattttttttata
gttatgcctattataattggaggatttggaaattgattagtacctttaatattaggagccccagatatagcatttccacgaataaataatataagattttgattatta
ccaccttcattaactttattaatttcaagaagaattgttgaaaatggggctggtactggatgaacagtgtatcctcctttatcctcaaatattgctcaccaaggttcttct
gttgatttagcaattttttctcttcatttagctggaatttcatctattttaggagctattaattttattacaacaattattaatatacgaattaaaaatttatcttttgatcaa
ataccattatttgtttgagctgtaggaattacagcaattttactattactttctttacctgttttagccggagctattactatacttttaacagatcgaaatcttaatacttca
ttttttgatcctgcaggaggaggagatccaattttatatcaacattta
Barcode courtesy of the International Barcode of Life (iBOL) project.
About the collaborators
Paul Hebert, PhD, a globally recognized pioneer of DNA Barcoding, is Canada Research Chair of Molecular Biodiversity and Director of the Canadian Centre for DNA Barcoding at the Biodiversity Institute, University of Guelph, Ontario, Canada. He is also Principal Investigator on the International Barcode of Life (iBOL) project. Click here for more information about Dr. Hebert's work.
Dan Janzen, PhD, is an evolutionary ecologist, naturalist, and conservationist, and Dimaura Professor of Conservation Biology at the University of Pennsylvania. For 56 years he has spent much of his time doing field research in Costa Rica and since 1985 has been a founder and technical advisor to Area de ConservaciĂłn Guanacaste (ACG). ACG, 2% of Costa Rica and the size of New York City and all its suburbs, is the oldest, largest and most successful tropical habitat restoration project in the world, located just south of the Costa Rica-Nicaragua border. Click here for more information about Dr. Janzen's efforts.
Ontario Genomics Institute (OGI) is a private, not-for-profit corporation based in Toronto, Ontario, Canada, focused on using world-class research to create strategic genomics resources and accelerate Ontario’s development of a globally-competitive life sciences sector. Through its relationship with Genome Canada, the Ontario Ministry of Research and Innovation, and other private and public sector partners, OGI works to: identify, attract and support investment in Ontario-led genomics research; catalyze access to and the impact of genomics resources; and, raise the visibility of genomics as well as its impact and associated issues. Click here to return to our home page and learn more about OGI.
What is the Area de ConservaciĂłn Guanacaste?
A UNESCO World Heritage Site since 1999, the Area de Conservación Guanacaste (ACG) in Costa Rica is a vast protected ecosystem with an area of 120,000 terrestrial and 70,000 marine hectares. The ACG contains important natural habitats for the conservation of biological diversity – approximately 230,000 species in total – including the best dry forest habitats from Central America to northern Mexico and key habitats for endangered or rare plant and animal species. The site demonstrates significant ecological processes in both its terrestrial and marine-coastal environments. (*modified from UNESCO)
The mission of the ACG is to conserve the biodiversity of the ecosystems and the cultural heritage present in the ACG, as a model of development which integrates society in the management of the Area. Learn more here.
For more information, click on these links of interest:
The art of Joseph Rossano
• Joseph Rossano’s official site
• Bill Lowe Gallery, Atlanta
DNA barcoding
• Barcode of Life Data Systems
• Canadian Centre for DNA Barcoding
• International Barcode of Life (iBOL)
Biodiversity and conservation
• Area Conservacion de Guanacaste (Costa Rica)
Data and images from the ACG caterpillar rearing inventory
• Joe Rossano barcoded butterflies in Fusion Tables
• Other ACG barcoded butterflies in Fusion Table blog
• Janzen and Hallwachs caterpillar inventory database (*search for Bungalotis diophorus in the yellow box to the left)










