BOLD: the Art of DNA Barcoding

BOLD 8 - Aphrissa statira (with host plant Callichlamys latifolia)

Aphrissa statira w plant

Image courtesy of the Barcode of Life Data Systems

A note from Joseph Rossano:

As an artist, I strive to distill ideas, concepts, and reality into their bare essence.  My resulting minimalist sculptures, I hope, convey an emotion, ask a question, or direct the viewer on a path of introspection and investigation, as they explore man's impact on the environment.  My series "BOLD" is named for the acronym for the Barcode of Life Data Systems database. The subject of each specimen box is neither real nor is it an accurate representation of the creature it is designed to represent; rather, it is a jeweled representation of reality that draws the viewer in for a closer inspection.  What is the story of this specimen?  What is the text on the side of the piece?  What is a DNA barcode?  Read on for answers to these and other questions.

About Aphrissa statira - by Dr. Dan Janzen

“The butterflies are merciless today” said a cartoon burned into memory but lost to the bibliographer.  And so they were in late June, looking west down the channel of the paved entrance road at the official entrance to Area de ConservaciĂłn Guanacaste (ACG) at the Casetilla Entrada.  It was a river of large bright yellow butterflies pouring out of Sector Santa Rosa’s dry forest at the end of their first generation of the year. They passed in ones to 20s every few seconds, flying 1-4 m above the ground, males and females, the children output of parents that had arrived at the ACG dry forest a month earlier to lay their eggs on the new foliage of the beginning of the rainy season.  Aphrissa statira was one of the more common members of this mass of large Pieridae, along with five species of Phoebis and several more genera. 

From the ACG dry forest viewpoint, A. statira and many others are largely univoltine.  That is to say, they have one generation each year, conducted at the time when the food is highest quality and the parasite and predator regime is at its least intense.  But instead of being dormant as a pupa or a sexually-repressed adult, they leave.  They then have another generation(s) elsewhere in the wetter parts of Costa Rica.  The great-grandchildren, or yet further descended, return a year later to repeat.  

When ACG was one unbroken stretch of old-growth forest, from the Pacific coast to the Caribbean lowlands (as it will come to be again some day), the entrance of large yellow pierids with the first rains, their single dry forest generation, and their massive exit to wetter areas to the east, was probably very cleanly performed.  Today, a few individuals of some species stay behind, though not A. statira, to have 1-3 minimalist rainy season generations on the small ocean of food plants (especially Senna and Cassia, Fabaceae) in the early successional edges of dry forest roadsides and pastures.  A. statira is a specialist on the very new foliage of the old-growth huge and long-lived forest vine Callichlamys latifolia and the secondary successional woody vine Xylophragma seemannianum, both Bignoniaceae.  A. statira restricts itself to a single generation before leaving for points unknown.  The foliage-green caterpillars are both very abundant and very evident to any foraging bird, both because they perch on both sides of a leaf, and because their damage is often the first to be sustained by the new large leaves of their food plants.  However, there is safety in numbers and the forest at this time is rich in green edible caterpillars, apparently often satiating their avian predators.

Data and images about this species in the ACG can be explored in Google Fusion Tables.
 
Taken from Miller, J. C., Janzen, D. H. and Hallwachs, W. 2007.  100 Butterflies and moths.  Harvard University Press, Cambridge, Massachusetts.

About this piece – BOLD 8: Aphrissa statira by Joseph Rossano

If you look closely at the side of the encasement on this work of art, you’ll see a series of A’s, C’s, G’s and T’s.  They make up a DNA sequence, but not just any sequence – it’s a sequence unique to this species.  Each species has a different sequence at this particular spot in their DNA code.  Scientists call this sequence fragment a “DNA barcode”.  If each part of the sequence were represented by a different colour, it might look like:

DNA barcode schematic

What is a DNA barcode?

DNA barcoding uses a small fragment of a single gene in an organism’s DNA to identify the species to which that organism belongs, much like one might use a UPC barcode to distinguish different products.  These powerful tools are helping scientists to catalogue the world’s biodiversity.  The process began in Guelph, Ontario, Canada, and scientists here – like collaborator Dr. Paul Hebert of the Biodiversity Institute of Ontario (see below) – continue to lead international work aiming to catalogue the earth’s life forms completely.

More information:

DNA barcode of Aphrissa statira

MHAPA043-05|01-SRNP-14906|Aphrissa statira|COI-5P-acattatattttattttcggaatttgatccggaatagtaggaacttctttaagt
cttttaattcgaacagaattaggaaatcctggatcattaattggagatgatcaaatttataatactattgttacagctcatgcttttattataattttttttatagtaata
ccaattataattggaggatttggtaattgattagttcctttaatattaggagctccagatatagctttccctcgtataaataatataagtttttgacttttacccccatca
ttaacattattaatttctagaagtattgttgaaaacggagcaggaacaggatgaacagtgtaccccccactttcttctaatattgctcatagtggatcttcagtagac
ttagcaattttctcattacatcttgctggaatttcatctattttaggagctattaattttattacaactattattaatatacgaattaatagtatatcttttgatcaaatacca
ttatttgtttgagcagtaggtattacagctttacttttattattatcattgcctgttttagcaggagctattactatattattaactgatcgaaatttaaatacttcattttttg
atcctgctggaggaggagatccaattttatatcaacattta

Barcode courtesy of the International Barcode of Life (iBOL) project.

About the collaborators

Paul Hebert, PhD, a globally recognized pioneer of DNA Barcoding, is Canada Research Chair of Molecular Biodiversity and Director of the Canadian Centre for DNA Barcoding at the Biodiversity Institute, University of Guelph, Ontario, Canada.  He is also Principal Investigator on the International Barcode of Life (iBOL) project.  Click here for more information about Dr. Hebert's work.

Dan Janzen, PhD, is an evolutionary ecologist, naturalist, and conservationist, and Dimaura Professor of Conservation Biology at the University of Pennsylvania.  For 56 years he has spent much of his time doing field research in Costa Rica and since 1985 has been a founder and technical advisor to Area de ConservaciĂłn Guanacaste (ACG).  ACG, 2% of Costa Rica and the size of New York City and all its suburbs, is the oldest, largest and most successful tropical habitat restoration project in the world, located just south of the Costa Rica-Nicaragua border. Click here for more information about Dr. Janzen's efforts.

Ontario Genomics Institute (OGI) is a private, not-for-profit corporation based in Toronto, Ontario, Canada, focused on using world-class research to create strategic genomics resources and accelerate Ontario’s development of a globally-competitive life sciences sector.  Through its relationship with Genome Canada, the Ontario Ministry of Research and Innovation, and other private and public sector partners, OGI works to: identify, attract and support investment in Ontario-led genomics research; catalyze access to and the impact of genomics resources; and, raise the visibility of genomics as well as its impact and associated issues.  Click here to return to our home page and learn more about OGI.

What is the Area de ConservaciĂłn Guanacaste?

A UNESCO World Heritage Site since 1999, the Area de ConservaciĂłn Guanacaste (ACG) in Costa Rica is a vast protected ecosystem with an area of 120,000 terrestrial and 70,000 marine hectares.  The ACG contains important natural habitats for the conservation of biological diversity – approximately 230,000 species in total – including the best dry forest habitats from Central America to northern Mexico and key habitats for endangered or rare plant and animal species. The site demonstrates significant ecological processes in both its terrestrial and marine-coastal environments. (*modified from UNESCO)

The mission of the ACG is to conserve the biodiversity of the ecosystems and the cultural heritage present in the ACG, as a model of development which integrates society in the management of the Area. Learn more here.

For more information, click on these links of interest:

The art of Joseph Rossano
•    Joseph Rossano’s official site
•    Bill Lowe Gallery, Atlanta

DNA barcoding
•    Barcode of Life Data Systems
•    Canadian Centre for DNA Barcoding
•    International Barcode of Life (iBOL)

Biodiversity and conservation
•    Area Conservacion de Guanacaste (Costa Rica)

Data and images from the ACG caterpillar rearing inventory
•    Joe Rossano barcoded butterflies in Fusion Tables
•    Other ACG barcoded butterflies in Fusion Table blog
•    Janzen and Hallwachs caterpillar inventory database (*search for Aphrissa statira in the yellow box to the left)