BOLD: the Art of DNA Barcoding

BOLD 7 - Othorene veranaDHJ01 (with host plant Quercus oleoides)

Othorene veranaDHJ01 w plant

Image courtesy of the Barcode of Life Data Systems

A note from Joseph Rossano:

As an artist, I strive to distill ideas, concepts, and reality into their bare essence.  My resulting minimalist sculptures, I hope, convey an emotion, ask a question, or direct the viewer on a path of introspection and investigation, as they explore man's impact on the environment.  My series "BOLD" is named for the acronym for the Barcode of Life Data Systems database. The subject of each specimen box is neither real nor is it an accurate representation of the creature it is designed to represent; rather, it is a jeweled representation of reality that draws the viewer in for a closer inspection.  What is the story of this specimen?  What is the text on the side of the piece?  What is a DNA barcode?  Read on for answers to these and other questions.

About Othorene veranaDHJ01 - by Daniel H. Janzen

In the early 1980’s, when the Area de ConservaciĂłn Guanacaste (ACG) caterpillar inventory was newborn and focused on the dry forest of Sector Santa Rosa, the large caterpillars of Saturniidae fell quickly to the searchers.  Simultaneously, the adults at the light traps quickly tallied up to an asymptote – more nights and more years did not generate more species for the dry forest saturniid list.  There were 29 species at the lights and 28 species of caterpillars.  Where was the missing caterpillar of Othorene veranaDHJ01?  Common at the lights, though often confused by collectors with its look-alike Othorene purpurascens, O. veranaDHJ01 “must” have a common and large caterpillar, but it simply was not being found by all the haphazard searching by an ever increasing number of people.  

So, in 1984, in frustration, the inventory broke its own rule of not explicitly searching for any particular species (such explicit search is good way to seriously lower the inventory yield per dollar of US tax dollars spent).  Several plump egg-filled and fertilized females were caught at the lights, and they laid – as saturniids are wont to do – hundreds of eggs glued to the insides of their plastic bag cages.   Six days later they hatched and five of the hungry first instars were put into a small plastic bag with several leaves of a species of tree – 300 species to be exact.   It only took 24 hours to find the food plant of Othorene veranaDHJ01. 

The caterpillars rejected all species of tree leaves except those of Quercus oleoides (Fagaceae), the single common lowland tropical Central American oak (actually, Q. oleoides is really the same species as Q. virginiana, the Virginia live oak of the eastern and southern US, which magically changes its name to Q. oleioides about where it crosses the border into Mexico).  This evergreen oak once covered tens of thousands of hectares of ACG dry forest and still maintains what appears to be a healthy breeding population, which we now know supports a healthy breeding population of O. veranaDHJ01.  Once we knew the food plant, a few days of intense search of Q. oleoides adult tree crowns yielded the expected caterpillars of O. veranaDHJ01.  It is likely that intense light-trapping where Q. oleoides occurs throughout lowland Pacific Mesoamerica, and then across the Isthmus of Tehuantepec, and north to Monterrey would find a continuous population of O. veranaDHJ01; except that following barcoding of this moth in ACG, we find that the rainforest part of what appeared to be one species is in fact another species, bearing the interim name of Othorene veranaDHJ02.

Data and images about this species in the ACG can be explored in Google Fusion Tables.
 
Taken from Miller, J. C., Janzen, D. H. and Hallwachs, W. 2007.  100 Butterflies and moths.  Harvard University Press, Cambridge, Massachusetts.

About this piece – BOLD 7: Othorene veranaDHJ01 by Joseph Rossano

If you look closely at the side of the encasement on this work of art, you’ll see a series of A’s, C’s, G’s and T’s.  They make up a DNA sequence, but not just any sequence – it’s a sequence unique to this species.  Each species has a different sequence at this particular spot in their DNA code.  Scientists call this sequence fragment a “DNA barcode”.  If each part of the sequence were represented by a different colour, it might look like:

DNA barcode schematic

What is a DNA barcode?

DNA barcoding uses a small fragment of a single gene in an organism’s DNA to identify the species to which that organism belongs, much like one might use a UPC barcode to distinguish different products.  These powerful tools are helping scientists to catalogue the world’s biodiversity.  The process began in Guelph, Ontario, Canada, and scientists here – like collaborator Dr. Paul Hebert of the Biodiversity Institute of Ontario (see below) – continue to lead international work aiming to catalogue the earth’s life forms completely.

More information:

DNA barcode of Othorene veranaDHJ01

BLPCM616-08|08-SRNP-102213|Othorene verana|COI-5P-actttatattttatttttggaatctgagcaggaatagtaggaacatcatt
aagattattaattcgagcagaattaggtacccccagatctttaattggcgatgaccaaatttataatactattgttacagctcatgcttttattataattttttttatagt
aatacctattataatcggaggatttggtaattgattagtccccttaatactaggagctcctgatatagctttcccccgaataaataatataagtttttgattacttcccc
cctctttaactttattaatttcaagtagagtagtagaaaccggagctggaacaggatgaactgtttaccccccactctcttctaatattgctcatggtggatcttcagta
gatttagcaattttttcccttcatttagctggaatttcttcaattttaggagccattaattttattacaacaattattaatatacgtttaaataatatagatttcgatcaaat
acctttatttgtgtgagctgtaggtattacagcttttttacttcttttatcattacctgttttagcaggagctattaccatacttttaacagatcggaatttaaatacatcatt
ttttgaccctgcaggaggaggagaccctattctttatcaacattta

Barcode courtesy of the International Barcode of Life (iBOL) project.

About the collaborators

Paul Hebert, PhD, a globally recognized pioneer of DNA Barcoding, is Canada Research Chair of Molecular Biodiversity and Director of the Canadian Centre for DNA Barcoding at the Biodiversity Institute, University of Guelph, Ontario, Canada.  He is also Principal Investigator on the International Barcode of Life (iBOL) project.  Click here for more information about Dr. Hebert's work.

Dan Janzen, PhD, is an evolutionary ecologist, naturalist, and conservationist, and Dimaura Professor of Conservation Biology at the University of Pennsylvania.  For 56 years he has spent much of his time doing field research in Costa Rica and since 1985 has been a founder and technical advisor to Area de ConservaciĂłn Guanacaste (ACG).  ACG, 2% of Costa Rica and the size of New York City and all its suburbs, is the oldest, largest and most successful tropical habitat restoration project in the world, located just south of the Costa Rica-Nicaragua border. Click here for more information about Dr. Janzen's efforts.

Ontario Genomics Institute (OGI) is a private, not-for-profit corporation based in Toronto, Ontario, Canada, focused on using world-class research to create strategic genomics resources and accelerate Ontario’s development of a globally-competitive life sciences sector.  Through its relationship with Genome Canada, the Ontario Ministry of Research and Innovation, and other private and public sector partners, OGI works to: identify, attract and support investment in Ontario-led genomics research; catalyze access to and the impact of genomics resources; and, raise the visibility of genomics as well as its impact and associated issues.  Click here to return to our home page and learn more about OGI.

What is the Area de ConservaciĂłn Guanacaste?

A UNESCO World Heritage Site since 1999, the Area de ConservaciĂłn Guanacaste (ACG) in Costa Rica is a vast protected ecosystem with an area of 120,000 terrestrial and 70,000 marine hectares.  The ACG contains important natural habitats for the conservation of biological diversity – approximately 230,000 species in total – including the best dry forest habitats from Central America to northern Mexico and key habitats for endangered or rare plant and animal species. The site demonstrates significant ecological processes in both its terrestrial and marine-coastal environments. (*modified from UNESCO)

The mission of the ACG is to conserve the biodiversity of the ecosystems and the cultural heritage present in the ACG, as a model of development which integrates society in the management of the Area. Learn more here.

For more information, click on these links of interest:

The art of Joseph Rossano
•    Joseph Rossano’s official site
•    Bill Lowe Gallery, Atlanta

DNA barcoding
•    Barcode of Life Data Systems
•    Canadian Centre for DNA Barcoding
•    International Barcode of Life (iBOL)

Biodiversity and conservation
•    Area Conservacion de Guanacaste (Costa Rica)

Data and images from the ACG caterpillar rearing inventory
•    Joe Rossano barcoded butterflies in Fusion Tables
•    Other ACG barcoded butterflies in Fusion Table blog
•    Janzen and Hallwachs caterpillar inventory database (*search for Othorene veranaDHJ01 in the yellow box to the left)