BOLD 6 - Siderone galanthis (with host plant Zuelania guidonia)

Image courtesy of the Barcode of Life Data Systems
A note from Joseph Rossano:
As an artist, I strive to distill ideas, concepts, and reality into their bare essence. My resulting minimalist sculptures, I hope, convey an emotion, ask a question, or direct the viewer on a path of introspection and investigation, as they explore man's impact on the environment. My series "BOLD" is named for the acronym for the Barcode of Life Data Systems database. The subject of each specimen box is neither real nor is it an accurate representation of the creature it is designed to represent; rather, it is a jeweled representation of reality that draws the viewer in for a closer inspection. What is the story of this specimen? What is the text on the side of the piece? What is a DNA barcode? Read on for answers to these and other questions.
About Siderone galanthis - by Daniel H. Janzen
Staring idly into the top of a dry forest oak tree on a long hot dry season afternoon, one comes to the sudden realization that there is a brilliant red flapping dot that appears periodically against the blue sky. For an hour it fools you into thinking that it is an Agrias amydon repteatedly launching and perching on the sap flow from a wounded Quercus oleoides branch – which is festooned with what appear to be flaps of bark but are actually slightly tipsy Memphis, Anaea, Archaeoprepona, Prepona, Historis and Myscelis, all congregated there to suck up the yeast-ridden fermenting sap (a.k.a. beer), and in the process transmit that same yeast to other newly damaged tree branches. But for some unknown reason, perhaps because it is shoved to the side by more aggressive butterflies, the red winged butterfly keeps leaping into the air for several turns before re-alighting. And then a pair of binoculars is produced and the red thing is pronounced to be Siderone galanthis (formerly, Siderone marthesia galanthis, but I am elevating the subspecies name to species level). The underside, like that of the other sap feeders, looks for all the world like a dead leaf or a dead flap of tree bark but the top bears the brilliant eye-catching red (as in blue for others, or even red and blue for Agrias amydon) that says, once the bearer is in the air, “don’t bother to try, yes, here I am, but I am way too fast”. However, again as with all these other species that catch the human eye so visibly, we really do not know to what degree the evolution of these colors has been intertwined with the evolution of courtship displays.
While adult S. galanthis are butterflies of the canopy, only rarely descending to a rotten fruit or a fermenting fruit-baited butterfly trap, the caterpillars are denizens of low shrubby treelets in the forest understory – Casearia sylvestris primarily but also Casearia nitida, C. tremula, C. arguta and Zuelania guidonia. All have been long treated as members of the tropical family Flacourtiaceae, but recent taxonomic changes have them now placed in the Salicaceae, the willow family, thereby giving Salicaceae a decidedly cosmopolitan distribution. The caterpillars begin their feeding life as tiny early instars perched at the tips of leaves, looking like a bit of trash hanging on the defoliated tip midrib. As they grow they come to look more and more like a piece of rolled dead leaf stuck to a twig or green leaf by a bit of spider silk or fungal hyphae. The bright green pupa hangs much like a small green fruit among the foliage, and some two weeks later the brilliant red of the about-to-eclose butterfly is quite visible for 24 hours through the clear cuticle of the pupal wall. After hardening its wings for a few hours, the newly eclosed adult zips up to the canopy to begin its adult life, which may last six months or even more. The adults are present, but not reproducing, throughout the long dry season, not migrating away from Area de Conservación Guanacaste (ACG) dry forest, though they do seem to be most abundant in or beneath the often evergreen tree crowns in the forest along dry creek beds. S. galanthis also occurs in ACG rain forest, but essentially nothing is known of its biology there.
Data and images about this species in the ACG can be explored in Google Fusion Tables.
Taken from Miller, J. C., Janzen, D. H. and Hallwachs, W. 2007. 100 Butterflies and moths. Harvard University Press, Cambridge, Massachusetts.
About this piece – BOLD 6: Siderone galanthis by Joseph Rossano
If you look closely at the side of the encasement on this work of art, you’ll see a series of A’s, C’s, G’s and T’s. They make up a DNA sequence, but not just any sequence – it’s a sequence unique to this species. Each species has a different sequence at this particular spot in their DNA code. Scientists call this sequence fragment a “DNA barcode”. If each part of the sequence were represented by a different colour, it might look like:
What is a DNA barcode?
DNA barcoding uses a small fragment of a single gene in an organism’s DNA to identify the species to which that organism belongs, much like one might use a UPC barcode to distinguish different products. These powerful tools are helping scientists to catalogue the world’s biodiversity. The process began in Guelph, Ontario, Canada, and scientists here – like collaborator Dr. Paul Hebert of the Biodiversity Institute of Ontario (see below) – continue to lead international work aiming to catalogue the earth’s life forms completely.
More information:
- View a video of Dr. Dan Janzen discussing DNA Barcoding.
- Learn more about using DNA barcoding to advance the discovery and identification of butterflies, moths, and skippers (i.e. Lepidoptera).
- Learn about the International Barcode of Life (iBOL) project, an Ontario-led worldwide effort to use DNA barcoding to identify all the species in the world.
DNA barcode of Siderone galanthis
MHMXA939-06|06-SRNP-55238|Siderone galanthis|COI-5P-actttatattttatttttggaatttgagccggaatagttggaacttccctt
agtttaattattcgtactgaattaggaaatccaggatttttaattggagacgatcaaatttacaatactatcgtaacagctcatgcttttattataattttttttatagt
catacctatcataattggaggatttggtaattgattagttcctcttatactcggagcccctgatatagctttcccccgaataaataatataagattttgactcttacccc
cctccctaattcttttaatttcaagtagaattgtagaaaatggagcaggaactggatgaacagtttatcctcccctgtcttctaatattgcccatagaggttcatcagt
agatttagctattttttcccttcatttagcaggaatttcatctattttaggagcaattaattttattactacaattattaatatacgagtaaataatatatcttatgatcaa
atacctttatttatttgatccgtaggaattactgcattattattattactttctttacccgttttagcaggagcaattaccatactactaacagatcgaaatttaaatactt
ctttttttgatcctgctggaggaggagatcctattttataccaacattta
Barcode courtesy of the International Barcode of Life (iBOL) project.
About the collaborators
Paul Hebert, PhD, a globally recognized pioneer of DNA Barcoding, is Canada Research Chair of Molecular Biodiversity and Director of the Canadian Centre for DNA Barcoding at the Biodiversity Institute, University of Guelph, Ontario, Canada. He is also Principal Investigator on the International Barcode of Life (iBOL) project. Click here for more information about Dr. Hebert's work.
Dan Janzen, PhD, is an evolutionary ecologist, naturalist, and conservationist, and Dimaura Professor of Conservation Biology at the University of Pennsylvania. For 56 years he has spent much of his time doing field research in Costa Rica and since 1985 has been a founder and technical advisor to Area de ConservaciĂłn Guanacaste (ACG). ACG, 2% of Costa Rica and the size of New York City and all its suburbs, is the oldest, largest and most successful tropical habitat restoration project in the world, located just south of the Costa Rica-Nicaragua border. Click here for more information about Dr. Janzen's efforts.
Ontario Genomics Institute (OGI) is a private, not-for-profit corporation based in Toronto, Ontario, Canada, focused on using world-class research to create strategic genomics resources and accelerate Ontario’s development of a globally-competitive life sciences sector. Through its relationship with Genome Canada, the Ontario Ministry of Research and Innovation, and other private and public sector partners, OGI works to: identify, attract and support investment in Ontario-led genomics research; catalyze access to and the impact of genomics resources; and, raise the visibility of genomics as well as its impact and associated issues. Click here to return to our home page and learn more about OGI.
What is the Area de ConservaciĂłn Guanacaste?
A UNESCO World Heritage Site since 1999, the Area de Conservación Guanacaste (ACG) in Costa Rica is a vast protected ecosystem with an area of 120,000 terrestrial and 70,000 marine hectares. The ACG contains important natural habitats for the conservation of biological diversity – approximately 230,000 species in total – including the best dry forest habitats from Central America to northern Mexico and key habitats for endangered or rare plant and animal species. The site demonstrates significant ecological processes in both its terrestrial and marine-coastal environments. (*modified from UNESCO)
The mission of the ACG is to conserve the biodiversity of the ecosystems and the cultural heritage present in the ACG, as a model of development which integrates society in the management of the Area. Learn more here.
For more information, click on these links of interest:
The art of Joseph Rossano
• Joseph Rossano’s official site
• Bill Lowe Gallery, Atlanta
DNA barcoding
• Barcode of Life Data Systems
• Canadian Centre for DNA Barcoding
• International Barcode of Life (iBOL)
Biodiversity and conservation
• Area Conservacion de Guanacaste (Costa Rica)
Data and images from the ACG caterpillar rearing inventory
• Joe Rossano barcoded butterflies in Fusion Tables
• Other ACG barcoded butterflies in Fusion Table blog
• Janzen and Hallwachs caterpillar inventory database (*search for Siderone galanthis in the yellow box to the left)










