BOLD 5 - Adelpha basiloides (with host plant Alibertia edulis)

Image courtesy of the Barcode of Life Data Systems

A note from Joseph Rossano:

As an artist, I strive to distill ideas, concepts, and reality into their bare essence.  My resulting minimalist sculptures, I hope, convey an emotion, ask a question, or direct the viewer on a path of introspection and investigation, as they explore man's impact on the environment.  My series "BOLD" is named for the acronym for the Barcode of Life Data Systems database. The subject of each specimen box is neither real nor is it an accurate representation of the creature it is designed to represent; rather, it is a jeweled representation of reality that draws the viewer in for a closer inspection.  What is the story of this specimen?  What is the text on the side of the piece?  What is a DNA barcode?  Read on for answers to these and other questions.

About Adelpha basiloides - by Daniel H. Janzen

If there was ever a mimetic mess among the adult Area de Conservación Guanacaste (ACG) Nymphalidae, it is Adelpha.  Some 16 of the 19 ACG species reared to date look like one or more of each other (especially when flying), except for the two cloud forest species, Adelpha tracta and Adelpha demialba.  These two deviate from the lowland generic morph, as is commonplace when there is a group with many lowland species and a few occupying upper elevations.  And the “Adelpha color pattern” – here portrayed by Adelpha basiloides - plays out in seemingly infinite minor variation over more than 100 other Neotropical species (with even a few in North America).  But among all of these in the ACG, there was one that was common, distinctive for a single trait in the forewing, and quite simply, Adelpha basiloides.  No doubts.  The distinctive split white cell at the top of the column of white cells marching up the forewing separates it from all the others.

That is, until we got its DNA barcodes.  What the world knows as A. basiloides is clearly two entities in ACG.   One, now known as Adelpha basiloidesDHJ01 until we can figure out what it really is, is basically the dry forest species, while Adelpha basiloidesDHJ02 appears to be primarily occupying the interface between rain forest and dry forest.  But the two certainly can be found in the same place and the caterpillars feed on the same species of plants, in the zone of overlap of the two major ACG ecosystems.

But what does that orange and white pattern on a dark brown background mean in the life of an Adelpha?   It is easy to suspect that it is indeed an aposematic coloration, both because these butterflies fly, float, flap and perch in the vicinity of fly-catching birds that certainly should have the ability to catch Adelpha, yet are ignored by the birds.  And the largely, though not entirely, rubiaceous food plants for many species of their (cryptic) caterpillars certainly do contain enough potentially toxic alkaloids that they could be sequestered as defensive chemicals.  But this is yet one more case where only detailed, and perhaps somewhat unpleasant, experiments could determine if they are models, mimics or both.  It will not be fun to feed them to birds. Certainly there are numerous other riodinid and nymphalid butterflies that bear the same color pattern, apparently mimicking Adelpha and forming a yet larger mimetic complex.  Among the more dramatic dramatic are the several species of Doxocopa – such as the female of Doxocopa pavon and both sexes of Doxocopa laure – that belong to a quite different nymphalid subfamily from Adelpha, and yet contain species that are extremely similar to Adelpha.

Data and images about this species in the ACG can be explored in Google Fusion Tables.

Taken from Miller, J. C., Janzen, D. H. and Hallwachs, W. 2007.  100 Butterflies and moths.  Harvard University Press, Cambridge, Massachusetts.

About this piece – BOLD 5: Adelpha basiloides by Joseph Rossano

If you look closely at the side of the encasement on this work of art, you’ll see a series of A’s, C’s, G’s and T’s.  They make up a DNA sequence, but not just any sequence – it’s a sequence unique to this species.  Each species has a different sequence at this particular spot in their DNA code.  Scientists call this sequence fragment a “DNA barcode”.  If each part of the sequence were represented by a different colour, it might look like:

What is a DNA barcode?

DNA barcoding uses a small fragment of a single gene in an organism’s DNA to identify the species to which that organism belongs, much like one might use a UPC barcode to distinguish different products.  These powerful tools are helping scientists to catalogue the world’s biodiversity.  The process began in Guelph, Ontario, Canada, and scientists here – like collaborator Dr. Paul Hebert of the Biodiversity Institute of Ontario (see below) – continue to lead international work aiming to catalogue the earth’s life forms completely.

More information:

• View a video of Dr. Dan Janzen discussing DNA Barcoding.
• Learn more about using DNA barcoding to advance the discovery and identification of butterflies, moths, and skippers (i.e. Lepidoptera).
• Learn about the International Barcode of Life (iBOL) project, an Ontario-led worldwide effort to use DNA barcoding to identify all the species in the world.

DNA barcode of Adelpha basiloides

MHAAC121-06|05-SRNP-24300|Adelpha basiloidesDHJ01|COI-5P-actttatattttatttttggaatttgagcaggaatagtaggaa
cttctttaagtttattaattcgtgttgaattaggaaacccaggctctttaattggagatgaccaaatttataatactattgttactgcacatgcttttattataatttttttt
atagtaatacctattataattggaggatttggaaattgattagtaccccttatactaggagccccagatatagccttcccccgtataaataatataagattttgactt
ctacctccttctttaattttattaatttcgagtagaattgttgaaaatggagcaggaacaggatgaacagtttacccacccctttcatctaatatcgctcatggaggat
cttcagttgatctagctattttttccctacatttagctggaatttcatcaattttaggagcaattaattttattacaactattattaatatgcgagttaataatatatcttatg
atcaaatacctttatttgtgtgatcagtagttattacagctcttttattattactatctcttccagtattagcaggagctattactatacttttaacagatcgtaatttaaata
cctctttttttgatcctgctggaggaggggatcctattttataccaacatttg

Barcode courtesy of the International Barcode of Life (iBOL) project.

About the collaborators

Paul Hebert, PhD, a globally recognized pioneer of DNA Barcoding, is Canada Research Chair of Molecular Biodiversity and Director of the Canadian Centre for DNA Barcoding at the Biodiversity Institute, University of Guelph, Ontario, Canada.  He is also Principal Investigator on the International Barcode of Life (iBOL) project.  Click here for more information about Dr. Hebert's work.

Dan Janzen, PhD, is an evolutionary ecologist, naturalist, and conservationist, and Dimaura Professor of Conservation Biology at the University of Pennsylvania.  For 56 years he has spent much of his time doing field research in Costa Rica and since 1985 has been a founder and technical advisor to Area de Conservación Guanacaste (ACG).  ACG, 2% of Costa Rica and the size of New York City and all its suburbs, is the oldest, largest and most successful tropical habitat restoration project in the world, located just south of the Costa Rica-Nicaragua border. Click here for more information about Dr. Janzen's efforts.

Ontario Genomics Institute (OGI) is a private, not-for-profit corporation based in Toronto, Ontario, Canada, focused on using world-class research to create strategic genomics resources and accelerate Ontario’s development of a globally-competitive life sciences sector.  Through its relationship with Genome Canada, the Ontario Ministry of Research and Innovation, and other private and public sector partners, OGI works to: identify, attract and support investment in Ontario-led genomics research; catalyze access to and the impact of genomics resources; and, raise the visibility of genomics as well as its impact and associated issues.  Click here to return to our home page and learn more about OGI.

What is the Area de Conservación Guanacaste?

A UNESCO World Heritage Site since 1999, the Area de Conservación Guanacaste (ACG) in Costa Rica is a vast protected ecosystem with an area of 120,000 terrestrial and 70,000 marine hectares.  The ACG contains important natural habitats for the conservation of biological diversity – approximately 230,000 species in total – including the best dry forest habitats from Central America to northern Mexico and key habitats for endangered or rare plant and animal species. The site demonstrates significant ecological processes in both its terrestrial and marine-coastal environments. (*modified from UNESCO)

The mission of the ACG is to conserve the biodiversity of the ecosystems and the cultural heritage present in the ACG, as a model of development which integrates society in the management of the Area. Learn more here.

For more information, click on these links of interest:

The art of Joseph Rossano
•    Joseph Rossano’s official site
•    Bill Lowe Gallery, Atlanta

DNA barcoding
•    Barcode of Life Data Systems
•    Canadian Centre for DNA Barcoding
•    International Barcode of Life (iBOL)

Biodiversity and conservation
•    Area Conservacion de Guanacaste (Costa Rica)

Data and images from the ACG caterpillar rearing inventory
•    Joe Rossano barcoded butterflies in Fusion Tables
•    Other ACG barcoded butterflies in Fusion Table blog
•    Janzen and Hallwachs caterpillar inventory database (*search for Adelpha basiloides in the yellow box to the left)