BOLD 4 - Azeta rhodogaster (with host plant Gliricidia sepium)

Image courtesy of the Barcode of Life Data Systems
A note from Joseph Rossano:
As an artist, I strive to distill ideas, concepts, and reality into their bare essence. My resulting minimalist sculptures, I hope, convey an emotion, ask a question, or direct the viewer on a path of introspection and investigation, as they explore man's impact on the environment. My series "BOLD" is named for the acronym for the Barcode of Life Data Systems database. The subject of each specimen box is neither real nor is it an accurate representation of the creature it is designed to represent; rather, it is a jeweled representation of reality that draws the viewer in for a closer inspection. What is the story of this specimen? What is the text on the side of the piece? What is a DNA barcode? Read on for answers to these and other questions.
About Azeta rhodogaster - by Daniel H. Janzen
If you see a noctuid moth in Area de ConservaciĂłn Guanacaste (ACG) with a red abdomen, it is Azeta rhodogaster (as its species epithet suggests). There is no other like it. Equally, as the bright red abdomen suggests, this species is rather more diurnal and rather more inclined to fly when a predator approaches, than are many hundreds of other species of ACG Noctuidae. It perches exposed on the foliage, watches for movement with its large eyes, and flees when approached. It is very likely that the red abdomen functions as do the yellow hind wings on so many noctuids: The searching bird zeroes in on the red as the moth is in flight, but the red abruptly disappears when the moth alights, often under a leaf or otherwise somewhat concealed. There is no suggestion that the red abdomen is aposematic, flagging a toxic meal on wings.
And the caterpillar of A. rhodogaster also steers the researcher away from aposematism. The pale greenish-yellowish-with-black dots caterpillars are host-specific to Gliricidia sepium (Fabaceae), a small to very large native tree of ACG dry forest. This dry forest tree has been introduced around the global tropics, in both dry and rain forest, as a living fence post. When this tree was planted as the support for barbed wire fences in the rain forest side of Costa Rica, A. rhodogaster was just one of the many dry forest species that moved from dry to rain forest pastures, following its food plant (conspicuous others are Epargyreus Burns02 in the Hesperiidae and Dasylophia basitincta in the Notodontidae).
A. rhodogaster caterpillars can reach quite spectacular abundances, quite defoliating their food plants if they are just saplings or young treelets. At these times, it is easy to collect many of the caterpillars so as to see what parasitoids are using them and it is apparently also easy for their parasitoids to find them. In one sample of 446 mostly last instar caterpillars collected during a population explosion from a few G. sepium treelets in ACG dry forest, Eucelatoria armigera, a medium-sized somewhat generalist tachinid fly, killed at least 40 percent of the caterpillars. Interestingly, this species of caterpillar does not seem to have any species of parasitoid that is a specialist on it.
Data and images about this species in the ACG can be explored in Google Fusion Tables.
Taken from Miller, J. C., Janzen, D. H. and Hallwachs, W. 2007. 100 Butterflies and moths. Harvard University Press, Cambridge, Massachusetts.
About this piece – BOLD 4: Azeta rhodogaster by Joseph Rossano
If you look closely at the side of the encasement on this work of art, you’ll see a series of A’s, C’s, G’s and T’s. They make up a DNA sequence, but not just any sequence – it’s a sequence unique to this species. Each species has a different sequence at this particular spot in their DNA code. Scientists call this sequence fragment a “DNA barcode”. If each part of the sequence were represented by a different colour, it might look like:
What is a DNA barcode?
DNA barcoding uses a small fragment of a single gene in an organism’s DNA to identify the species to which that organism belongs, much like one might use a UPC barcode to distinguish different products. These powerful tools are helping scientists to catalogue the world’s biodiversity. The process began in Guelph, Ontario, Canada, and scientists here – like collaborator Dr. Paul Hebert of the Biodiversity Institute of Ontario (see below) – continue to lead international work aiming to catalogue the earth’s life forms completely.
More information:
- View a video of Dr. Dan Janzen discussing DNA Barcoding.
- Learn more about using DNA barcoding to advance the discovery and identification of butterflies, moths, and skippers (i.e. Lepidoptera).
- Learn about the International Barcode of Life (iBOL) project, an Ontario-led worldwide effort to use DNA barcoding to identify all the species in the world.
DNA barcode of Azeta rhodogaster
MHAUA236-05|03-SRNP-18316|Azeta rhodogaster|COI-5P-actttatattttatttttggtatttgagcaggtatagtaggtacttcactaa
gattattaattcgagctgaattaggtaatccaggttcattaatcggtgatgatcaaatttataatactattgttacagctcatgcttttattataattttttttatagttata
cctattataattggaggatttggtaattgattagtcccacttatattaggagctcctgatatagctttcccccgaataaataatataagattttgattactccccccctcttt
aactttattaatttcaagaagaattgtagaaaacggagctggaactggatgaaccgtttacccccccttatcttctaatattgcacatggtggtagttcagtagattta
gctatcttttcccttcatttagctggaatctcatctattttaggtgcaattaattttattactactattattaatatacgattaaataatttatcatttgatcaaataccattattt
gtttgagctgttggtattacagctttcttattgcttttatctttacctgtattagctggagctattactatactattaacagatcgaaatttaaatacatctttttttgatcctgc
gggagggggtgaccctattttataccaacattta
Barcode courtesy of the International Barcode of Life (iBOL) project.
About the collaborators
Paul Hebert, PhD, a globally recognized pioneer of DNA Barcoding, is Canada Research Chair of Molecular Biodiversity and Director of the Canadian Centre for DNA Barcoding at the Biodiversity Institute, University of Guelph, Ontario, Canada. He is also Principal Investigator on the International Barcode of Life (iBOL) project. Click here for more information about Dr. Hebert's work.
Dan Janzen, PhD, is an evolutionary ecologist, naturalist, and conservationist, and Dimaura Professor of Conservation Biology at the University of Pennsylvania. For 56 years he has spent much of his time doing field research in Costa Rica and since 1985 has been a founder and technical advisor to Area de ConservaciĂłn Guanacaste (ACG). ACG, 2% of Costa Rica and the size of New York City and all its suburbs, is the oldest, largest and most successful tropical habitat restoration project in the world, located just south of the Costa Rica-Nicaragua border. Click here for more information about Dr. Janzen's efforts.
Ontario Genomics Institute (OGI) is a private, not-for-profit corporation based in Toronto, Ontario, Canada, focused on using world-class research to create strategic genomics resources and accelerate Ontario’s development of a globally-competitive life sciences sector. Through its relationship with Genome Canada, the Ontario Ministry of Research and Innovation, and other private and public sector partners, OGI works to: identify, attract and support investment in Ontario-led genomics research; catalyze access to and the impact of genomics resources; and, raise the visibility of genomics as well as its impact and associated issues. Click here to return to our home page and learn more about OGI.
What is the Area de ConservaciĂłn Guanacaste?
A UNESCO World Heritage Site since 1999, the Area de Conservación Guanacaste (ACG) in Costa Rica is a vast protected ecosystem with an area of 120,000 terrestrial and 70,000 marine hectares. The ACG contains important natural habitats for the conservation of biological diversity – approximately 230,000 species in total – including the best dry forest habitats from Central America to northern Mexico and key habitats for endangered or rare plant and animal species. The site demonstrates significant ecological processes in both its terrestrial and marine-coastal environments. (*modified from UNESCO)
The mission of the ACG is to conserve the biodiversity of the ecosystems and the cultural heritage present in the ACG, as a model of development which integrates society in the management of the Area. Learn more here.
For more information, click on these links of interest:
The art of Joseph Rossano
• Joseph Rossano’s official site
• Bill Lowe Gallery, Atlanta
DNA barcoding
• Barcode of Life Data Systems
• Canadian Centre for DNA Barcoding
• International Barcode of Life (iBOL)
Biodiversity and conservation
• Area Conservacion de Guanacaste (Costa Rica)
Data and images from the ACG caterpillar rearing inventory
• Joe Rossano barcoded butterflies in Fusion Tables
• Other ACG barcoded butterflies in Fusion Table blog
• Janzen and Hallwachs caterpillar inventory database (*search for Azeta rhodogaster in the yellow box to the left)










