BOLD: The Art of DNA Barcoding

BOLD 3 - Tithorea pinthias

Tithorea pinthias

Image courtesy of the Barcode of Life Data Systems

A note from Joseph Rossano:

As an artist, I strive to distill ideas, concepts, and reality into their bare essence.  My resulting minimalist sculptures, I hope, convey an emotion, ask a question, or direct the viewer on a path of introspection and investigation, as they explore man's impact on the environment.  My series "BOLD" is named for the acronym for the Barcode of Life Data Systems database. The subject of each specimen box is neither real nor is it an accurate representation of the creature it is designed to represent; rather, it is a jeweled representation of reality that draws the viewer in for a closer inspection.  What is the story of this specimen?  What is the text on the side of the piece?  What is a DNA barcode?  Read on for answers to these and other questions.

About Tithorea pinthias - by Dr. Dan Janzen

At first glance, Tithorea pinthias (also known as Tithorea tarricina pinthias) is just one more toxic-to-eat Mullerian mimic flapping or sailing along a rain forest trail, with its rusty red hind wings and black-with-yellow-spotted forewings.  And comparing it, even in detail rather than the blur of flight, with Heliconius hecale just reinforces that conclusion.   And when spreading the comparison, it quickly becomes obvious that this pattern is populated by dozens of species of Mullerian mimic ithomiine and heliconiine nymphalids, pericopine arctiids, and probably others, with scattered Batesian satellites not only in Costa Rica but throughout the neotropics  (browse the plates of Butterflies of Costa Rica (DeVries 1987) or Bill Haber’s web site for the butterflies of Monteverde).  And as has been said before and will be said again, in addition to the classical concept of mimicry as largely a learning-based phenomenon, it may well be that the birds are even genetically hard-wired to ignore this color pattern.

But the story is broader.  In 2005, an entire issue of Nearctic Lepidoptera was devoted to the regal fritillary, Speyeria idalia. This very large and very attractive endangered US species of nymphalid butterfly once ranged widely in the northern half of the US east of the Rocky Mountains.  It was just about everywhere that there was tall grass prairie accompanied by the violet leaves (Violaceae) that its caterpillars eat.  Now it is reduced to a few enclaves dotted over that once large distribution.   For those brought up on the US butterfly fauna, S. idalia is an outstanding color pattern, not duplicated elsewhere in Kansas, Indiana or the Dakotas (or anywhere else in the US).  Mimicry never crosses your mind.  Yet there is a mental itch.  The butterfly has relatively slow, flapping and ostentatious flight.  It perches on flowers with its wings wide open, advertising to the world.  And its flight is a blur of orange, and black with white/yellowish/silver spots.  Its hind wings are black with white spots, and the forewings are orange (with some scattered black etchings).  In short, it is Tithorea pinthias or Heliconius hecale inverted (on the underside as well, but first focus just on the upper side).   But you feel that the predators of the T. pinthias Mullerian ring are in the neotropics, not Kansas?  When the birds migrate north in the spring, they do not leave behind their genetics and their knowledge.

Data and images about this species in the ACG can be explored in Google Fusion Tables.

Taken from Miller, J. C., Janzen, D. H. and Hallwachs, W. 2007.  100 Butterflies and moths.  Harvard University Press, Cambridge, Massachusetts.

About this piece – BOLD 3: Tithorea pinthias by Joseph Rossano

If you look closely at the side of the encasement on this work of art, you’ll see a series of A’s, C’s, G’s and T’s.  They make up a DNA sequence, but not just any sequence – it’s a sequence unique to this species.  Each species has a different sequence at this particular spot in their DNA code.  Scientists call this sequence fragment a “DNA barcode”.  If each part of the sequence were represented by a different colour, it might look like:

DNA barcode schematic

What is a DNA barcode?

DNA barcoding uses a small fragment of a single gene in an organism’s DNA to identify the species to which that organism belongs, much like one might use a UPC barcode to distinguish different products.  These powerful tools are helping scientists to catalogue the world’s biodiversity.  The process began in Guelph, Ontario, Canada, and scientists here – like collaborator Dr. Paul Hebert of the Biodiversity Institute of Ontario (see below) – continue to lead international work aiming to catalogue the earth’s life forms completely.

More information:

DNA barcode of Tithorea pinthias

MHMXE493-06|06-SRNP-31711|Tithorea pinthias|COI-5P-accttatattttatttttggaatttgagcaggtatagtaggtacatctctt
agtcttttaattcgaacagaattaggaactcctggatctttaattggagatgatcaaatttataatactatcgttacagctcatgcttttattataattttctttatag
ttatacctattataattggaggatttggtaattgattaattcctttaatattgggtgctcctgatatagctttcccccgaataaataatataagtttttgacttttaccc
ccatcattaatacttttaatttcaagaagaatcgtagaaaatggagctggtacaggttggacagtttaccccccactttcatcaaatatcgctcatagaggatct
tcagtagatttagcaattttttccctacatttagccggtatttcatctattttaggggcaattaattttatcacaacaattattaatatacgaattaataatatatcttt
cgatcaaataccattatttgtttgagcagtgggaattacagctttacttttattattatctttacctgtactagcaggtgcaatcactatacttttaactgatcgaaat
ttaaatacatcattttttgaccccgcaggagggggagaccccatcctttatcaacattta

Barcode courtesy of the International Barcode of Life (iBOL) project.

About the collaborators

Paul Hebert, PhD, a globally recognized pioneer of DNA Barcoding, is Canada Research Chair of Molecular Biodiversity and Director of the Canadian Centre for DNA Barcoding at the Biodiversity Institute, University of Guelph, Ontario, Canada.  He is also Principal Investigator on the International Barcode of Life (iBOL) project.  Click here for more information about Dr. Hebert's work.

Dan Janzen, PhD, is an evolutionary ecologist, naturalist, and conservationist, and Dimaura Professor of Conservation Biology at the University of Pennsylvania.  For 56 years he has spent much of his time doing field research in Costa Rica and since 1985 has been a founder and technical advisor to Area de ConservaciĂłn Guanacaste (ACG).  ACG, 2% of Costa Rica and the size of New York City and all its suburbs, is the oldest, largest and most successful tropical habitat restoration project in the world, located just south of the Costa Rica-Nicaragua border. Click here for more information about Dr. Janzen's efforts.

Ontario Genomics Institute (OGI) is a private, not-for-profit corporation based in Toronto, Ontario, Canada, focused on using world-class research to create strategic genomics resources and accelerate Ontario’s development of a globally-competitive life sciences sector.  Through its relationship with Genome Canada, the Ontario Ministry of Research and Innovation, and other private and public sector partners, OGI works to: identify, attract and support investment in Ontario-led genomics research; catalyze access to and the impact of genomics resources; and, raise the visibility of genomics as well as its impact and associated issues.  Click here to return to our home page and learn more about OGI.

What is the Area de ConservaciĂłn Guanacaste?

A UNESCO World Heritage Site since 1999, the Area de ConservaciĂłn Guanacaste (ACG) in Costa Rica is a vast protected ecosystem with an area of 120,000 terrestrial and 70,000 marine hectares.  The ACG contains important natural habitats for the conservation of biological diversity – approximately 230,000 species in total – including the best dry forest habitats from Central America to northern Mexico and key habitats for endangered or rare plant and animal species. The site demonstrates significant ecological processes in both its terrestrial and marine-coastal environments. (*modified from UNESCO)

The mission of the ACG is to conserve the biodiversity of the ecosystems and the cultural heritage present in the ACG, as a model of development which integrates society in the management of the Area. Learn more here.

For more information, click on these links of interest:

The art of Joseph Rossano
•    Joseph Rossano’s official site
•    Habatat Galleries Chicago

DNA barcoding
•    Barcode of Life Data Systems
•    Canadian Centre for DNA Barcoding
•    International Barcode of Life (iBOL)

Biodiversity and conservation
•    Area Conservacion de Guanacaste (Costa Rica)

Data and images from the ACG caterpillar rearing inventory
•    Joe Rossano barcoded butterflies in Fusion Tables
•    Other ACG barcoded butterflies in Fusion Table blog
•    Janzen and Hallwachs caterpillar inventory database (*search for Tithorea pinthias in the yellow box to the left)