BOLD 2 - Belemnia trotschi

Image courtesy of the Barcode of Life Data Systems
A note from Joseph Rossano:
As an artist, I strive to distill ideas, concepts, and reality into their bare essence. My resulting minimalist sculptures, I hope, convey an emotion, ask a question, or direct the viewer on a path of introspection and investigation, as they explore man's impact on the environment. My series "BOLD" is named for the acronym for the Barcode of Life Data Systems database. The subject of each specimen box is neither real nor is it an accurate representation of the creature it is designed to represent; rather, it is a jeweled representation of reality that draws the viewer in for a closer inspection. What is the story of this specimen? What is the text on the side of the piece? What is a DNA barcode? Read on for answers to these and other questions.
About Belemnia trotschi - by Daniel H. Janzen
This day flying moth is in the “unbelievably gaudy” category. All that color is no accident of pigment physiology. Belemnia trotschi is undoubtedly saying something to the world, but what? The widespread belief among entomologists is that such bright colors are aposematic – colors that warn the observing monkey or bird not to touch or eat. This may well be the case, but there are caveats. First, the known Area de Conservación Guanacaste (ACG) food plant of the very cryptic caterpillar is Brosimum guianense (Moraceae). The fruits, seeds and foliage of this large tree are quite edible to vertebrates. The inference is that if this arctiid moth is toxic to the touch, taste or gut (as are believed to be many arctiid moths), it is very likely to be manufacturing its own toxins rather than merely extracting or sequestering them from the caterpillar food plant.
Second, we need to ask if the colors are displayed ostentatiously, or does this moth in nature actually match some gaudy background, like a flower or ripe fruit? The short answer is that the the adults do walk and fly ostentatiously in the full sun over foliage and flowers of many colors, but none of them are color matches for the moth. The moth is unambiguously displaying a flag. Third, a gaudy arctiid may be a Batesian mimic, quite edible but looking much like another truly obnoxious species. In the case of B. trotschi, it is unique, not looking like anything else in any tropical habitat known to us – though one can never fully discard the possibility that at the time of evolution of these colors, or in some other part of its range, there were a host of other look-alikes – Batesian and/or Mullerian mimics. Fourth, it may be that rather than these colors being an exact match of anything, they are simply a gaudy mess of bright signal that says to the predator’s genes or learning experiences “I am one of those bright gaudy things that you don’t want to mess with”. As such, it would be sharing a defense strategy with many tens of species of diurnal Arctiidae, Riodinidae, Noctuidae, Geometridae, and Nymphalidae.
In short, we will never really know the function of these brilliant colors until someone does choice experiments with potential predators in its habitat, and even unpleasant feeding experiments with naĂŻve predators. While there will be no single answer that works for all places at all times, at least the question can be addressed, now that we know how to rear B. trotschi.
Data and images about this species in the ACG can be explored in Google Fusion Tables.
Taken from Miller, J. C., Janzen, D. H. and Hallwachs, W. 2007. 100 Butterflies and moths. Harvard University Press, Cambridge, Massachusetts.
About this piece – BOLD 2: Belemnia trotschi by Joseph Rossano
If you look closely at the side of the encasement on this work of art, you’ll see a series of A’s, C’s, G’s and T’s. They make up a DNA sequence, but not just any sequence – it’s a sequence unique to this species. Each species has a different sequence at this particular spot in their DNA code. Scientists call this sequence fragment a “DNA barcode”. If each part of the sequence were represented by a different colour, it might look like:
What is a DNA barcode?
DNA barcoding uses a small fragment of a single gene in an organism’s DNA to identify the species to which that organism belongs, much like one might use a UPC barcode to distinguish different products. These powerful tools are helping scientists to catalogue the world’s biodiversity. The process began in Guelph, Ontario, Canada, and scientists here – like collaborator Dr. Paul Hebert of the Biodiversity Institute of Ontario (see below) – continue to lead international work aiming to catalogue the earth’s life forms completely.
More information:
- View a video of Dr. Dan Janzen discussing DNA Barcoding.
- Learn more about using DNA barcoding to advance the discovery and identification of butterflies, moths, and skippers (i.e. Lepidoptera).
- Learn about the International Barcode of Life (iBOL) project, an Ontario-led worldwide effort to use DNA barcoding to identify all the species in the world.
DNA barcode of Belemnia trotschi
MHARB157-05|05-SRNP-41060|Belemnia trotschi|COI-5P-acattatactttatttttggaatttgagctggaatagtaggaacttcat
taagattattgattcgagcagaattaggaaatcctggttcattaattggggacgatcaaatttataatactattgttacagcacatgcttttattataatttttttta
tagttataccaattataattggaggatttggtaattgacttgtacctttaatattaggagctccagatatagctttcccccgaataaataatataagtttttgacttt
tacccccctctttaacattattaatttcaagaagtattgtagaaaatggagcaggaacaggatgaacagtttaccccccactttcatcaaatattgcccatggcg
gcagttccgtagatttagctattttttcacttcatttagcaggaatttcttcaatcttaggagcaattaactttatcaccacaattattaatatacgattaaataattta
tccttcgatcaaatacccctttttatttgagcagtaggaattacagcatttttacttttactttccctacctgtattggctggagcaattactatacttttaaccgatcgaa
atcttaatacatcattttttgaccctgctggaggtggagaccctattctttatcaacattta
Barcode courtesy of the International Barcode of Life (iBOL) project.
About the collaborators
Paul Hebert, PhD, a globally recognized pioneer of DNA Barcoding, is Canada Research Chair of Molecular Biodiversity and Director of the Canadian Centre for DNA Barcoding at the Biodiversity Institute, University of Guelph, Ontario, Canada. He is also Principal Investigator on the International Barcode of Life (iBOL) project. Click here for more information about Dr. Hebert's work.
Dan Janzen, PhD, is an evolutionary ecologist, naturalist, and conservationist, and Dimaura Professor of Conservation Biology at the University of Pennsylvania. For 56 years he has spent much of his time doing field research in Costa Rica and since 1985 has been a founder and technical advisor to Area de ConservaciĂłn Guanacaste (ACG). ACG, 2% of Costa Rica and the size of New York City and all its suburbs, is the oldest, largest and most successful tropical habitat restoration project in the world, located just south of the Costa Rica-Nicaragua border. Click here for more information about Dr. Janzen's efforts.
Ontario Genomics Institute (OGI) is a private, not-for-profit corporation based in Toronto, Ontario, Canada, focused on using world-class research to create strategic genomics resources and accelerate Ontario’s development of a globally-competitive life sciences sector. Through its relationship with Genome Canada, the Ontario Ministry of Research and Innovation, and other private and public sector partners, OGI works to: identify, attract and support investment in Ontario-led genomics research; catalyze access to and the impact of genomics resources; and, raise the visibility of genomics as well as its impact and associated issues. Click here to return to our home page and learn more about OGI.
What is the Area de ConservaciĂłn Guanacaste?
A UNESCO World Heritage Site since 1999, the Area de Conservación Guanacaste (ACG) in Costa Rica is a vast protected ecosystem with an area of 120,000 terrestrial and 70,000 marine hectares. The ACG contains important natural habitats for the conservation of biological diversity – approximately 230,000 species in total – including the best dry forest habitats from Central America to northern Mexico and key habitats for endangered or rare plant and animal species. The site demonstrates significant ecological processes in both its terrestrial and marine-coastal environments. (*modified from UNESCO)
The mission of the ACG is to conserve the biodiversity of the ecosystems and the cultural heritage present in the ACG, as a model of development which integrates society in the management of the Area. Learn more here.
For more information, click on these links of interest:
The art of Joseph Rossano
• Joseph Rossano’s official site
DNA barcoding
• Barcode of Life Data Systems
• Canadian Centre for DNA Barcoding
• International Barcode of Life (iBOL)
Biodiversity and conservation
• Area Conservacion de Guanacaste (Costa Rica)
Data and images from the ACG caterpillar rearing inventory
• Joe Rossano barcoded butterflies in Fusion Tables
• Other ACG barcoded butterflies in Fusion Table blog
• Janzen and Hallwachs caterpillar inventory database (*search for Belemnia trotschi in the yellow box to the left)










