BOLD: the Art of DNA Barcoding

BOLD 14 - Erbessa salvini

Erbessa salvini

Image courtesy of the Barcode of Life Data Systems

A note from Joseph Rossano:

As an artist, I strive to distill ideas, concepts, and reality into their bare essence.  My resulting minimalist sculptures, I hope, convey an emotion, ask a question, or direct the viewer on a path of introspection and investigation, as they explore man's impact on the environment.  My series "BOLD" is named for the acronym for the Barcode of Life Data Systems database. The subject of each specimen box is neither real nor is it an accurate representation of the creature it is designed to represent; rather, it is a jeweled representation of reality that draws the viewer in for a closer inspection.  What is the story of this specimen?  What is the text on the side of the piece?  What is a DNA barcode?  Read on for answers to these and other questions.

About Erbessa salvini - by Daniel H. Janzen

Deviating from the classical notodontid color pattern and gestalt (e.g., see also Bardaxima perses and Calledema plusia) in the usual violent way of dioptine notodontids, Erbessa salvini bears a species epithet honoring Salvin of the famous pair of collectors/taxonomists Godman and Salvin who found so much and told us so much about the biodiversity of the Neotropics in the late 1800’s; their work lives on in the Biologia Centrali Americana

Compare E. salvini with Zunacetha annulata – instinct says that in no way are they related.  But these two day-flying moths of the same subfamily have simply been evolutionarily pushed into different mimicry complexes, perhaps by different predators in different places, or simply by the first color mutations taking one in one direction and the other in another direction, according to what by chance was present to mimic, or according to what by chance was present to drive the mimicry.   All three species of Area de ConservaciĂłn Guanacaste (ACG) Erbessa are of the same basic pattern of violent yellow patches on coal black, and flutter ostentatiously along path edges – an easy target if desired, and ignored target if inedible.  However, once again, the presumed inedibility could use some detailed field testing.  The melastomataceous food plants of the caterpillars – just Henriettea tuberculosa to date - are not famous for being rich in defensive chemistry obnoxious to vertebrates.  If Erebessa is toxic, the adult is probably ginning up its own nasty molecules.

While the adult of E. salvini has gone the direction of one kind of aposematism or mimcry, the caterpillar has gone another.  First, with its orange head and rear end, and green-pale striped-variegated body, it is a classical dioptine caterpillar, part of the huge mimicry ring of red-dark-white-red ACG caterpillars.  Whether these are Batesian, Mullerian, or simply avoided, is yet to be discovered.  But it has gone a step further in the never-ending evolutionary arms escalation.  So many notodontid caterpillars have the terminal prolegs evolutionarily projected into other structures that it is almost a signature of the family.  The most posterior prolegs of E. salvini are enormously extended into what can best be described as a white-tipped long black antenna, making the rear of the caterpillar appear to be the head end of some large insect. 

But what is the value of having the rear look like the head?  The classical answer is that if the predator strikes the more rubbery and less nerve-receptor-laden rear, the caterpillar has a higher chance of wiggling or falling away into the vegetation tangle below (and into which many a bird would be reluctant to dive in pursuit).  However, the white tip may signal something more significant.  The caterpillar of Hylesia continua, a common, highly urticating and often ostentatious black and white caterpillar in the same habitat, has the anterior black and white-tipped scoli enormously extended and clearly waves them about as part of its aposematic display.  The rear of E. salvini may be evolutionarily locked into the same defense.

Data and images about this species in the ACG can be explored in Google Fusion Tables.

Taken from Miller, J. C., Janzen, D. H. and Hallwachs, W. 2007.  100 Butterflies and moths.  Harvard University Press, Cambridge, Massachusetts.

About this piece – BOLD 14: Erbessa salvini by Joseph Rossano

If you look closely at the side of the encasement on this work of art, you’ll see a series of A’s, C’s, G’s and T’s.  They make up a DNA sequence, but not just any sequence – it’s a sequence unique to this species.  Each species has a different sequence at this particular spot in their DNA code.  Scientists call this sequence fragment a “DNA barcode”.  If each part of the sequence were represented by a different colour, it might look like:

DNA barcode schematic

What is a DNA barcode?

DNA barcoding uses a small fragment of a single gene in an organism’s DNA to identify the species to which that organism belongs, much like one might use a UPC barcode to distinguish different products.  These powerful tools are helping scientists to catalogue the world’s biodiversity.  The process began in Guelph, Ontario, Canada, and scientists here – like collaborator Dr. Paul Hebert of the Biodiversity Institute of Ontario (see below) – continue to lead international work aiming to catalogue the earth’s life forms completely.

More information:

DNA barcode of Erbessa salvini

MHANB609-05|04-SRNP-55059|Erbessa salvini|COI-5P-acattatattttatttttggaatttgagctggaatagtaggaacttctttaagc
ttattaattcgagctgaattaggaaacccaggatctttaattggagacgatcaaatttataatacaattgttacagctcatgcatttattataattttttttatagtaa
tgccaattataattggaggatttgggaactgacttgtccctttaatacttggggctcctgatatagcattcccccgtataaataatataagattttggttattgcccccc
tcattaacccttcttatttcaagaagaattgtagaaaatggagccggtacaggatgaacagtttacccccctttatcctctaatattgctcatagtggaagctctgttg
atttagcaattttttctcttcatttagctggtatttcttctattttaggggctattaatttcattacaacaattatcaatatacgtcttaatagaataacttttgatcaaatac
ctttatttgtttgagcagttggtattacagctttccttcttttactctctcttcctgtattagccggagcaattactatacttttaacagatcgaaatttaaatacctctttttttg
accctgctggaggaggggaccctattttataccaacattta

Barcode courtesy of the International Barcode of Life (iBOL) project.

About the collaborators

Paul Hebert, PhD, a globally recognized pioneer of DNA Barcoding, is Canada Research Chair of Molecular Biodiversity and Director of the Canadian Centre for DNA Barcoding at the Biodiversity Institute, University of Guelph, Ontario, Canada.  He is also Principal Investigator on the International Barcode of Life (iBOL) project.  Click here for more information about Dr. Hebert's work.

Dan Janzen, PhD, is an evolutionary ecologist, naturalist, and conservationist, and Dimaura Professor of Conservation Biology at the University of Pennsylvania.  For 56 years he has spent much of his time doing field research in Costa Rica and since 1985 has been a founder and technical advisor to Area de ConservaciĂłn Guanacaste (ACG).  ACG, 2% of Costa Rica and the size of New York City and all its suburbs, is the oldest, largest and most successful tropical habitat restoration project in the world, located just south of the Costa Rica-Nicaragua border. Click here for more information about Dr. Janzen's efforts.

Ontario Genomics Institute (OGI) is a private, not-for-profit corporation based in Toronto, Ontario, Canada, focused on using world-class research to create strategic genomics resources and accelerate Ontario’s development of a globally-competitive life sciences sector.  Through its relationship with Genome Canada, the Ontario Ministry of Research and Innovation, and other private and public sector partners, OGI works to: identify, attract and support investment in Ontario-led genomics research; catalyze access to and the impact of genomics resources; and, raise the visibility of genomics as well as its impact and associated issues.  Click here to return to our home page and learn more about OGI.

What is the Area de ConservaciĂłn Guanacaste?

A UNESCO World Heritage Site since 1999, the Area de ConservaciĂłn Guanacaste (ACG) in Costa Rica is a vast protected ecosystem with an area of 120,000 terrestrial and 70,000 marine hectares.  The ACG contains important natural habitats for the conservation of biological diversity – approximately 230,000 species in total – including the best dry forest habitats from Central America to northern Mexico and key habitats for endangered or rare plant and animal species. The site demonstrates significant ecological processes in both its terrestrial and marine-coastal environments. (*modified from UNESCO)

The mission of the ACG is to conserve the biodiversity of the ecosystems and the cultural heritage present in the ACG, as a model of development which integrates society in the management of the Area. Learn more here.

For more information, click on these links of interest:

The art of Joseph Rossano
•    Joseph Rossano’s official site
•    Bill Lowe Gallery, Atlanta

DNA barcoding
•    Barcode of Life Data Systems
•    Canadian Centre for DNA Barcoding
•    International Barcode of Life (iBOL)

Biodiversity and conservation
•    Area Conservacion de Guanacaste (Costa Rica)

Data and images from the ACG caterpillar rearing inventory
•    Joe Rossano barcoded butterflies in Fusion Tables
•    Other ACG barcoded butterflies in Fusion Table blog
•    Janzen and Hallwachs caterpillar inventory database (*search for Erbessa salvini in the yellow box to the left)