BOLD: the Art of DNA Barcoding

BOLD 12 - Mimoides clusoculis

Mimoides clusoculis

Image courtesy of the Barcode of Life Data Systems

A note from Joseph Rossano:

As an artist, I strive to distill ideas, concepts, and reality into their bare essence.  My resulting minimalist sculptures, I hope, convey an emotion, ask a question, or direct the viewer on a path of introspection and investigation, as they explore man's impact on the environment.  My series "BOLD" is named for the acronym for the Barcode of Life Data Systems database. The subject of each specimen box is neither real nor is it an accurate representation of the creature it is designed to represent; rather, it is a jeweled representation of reality that draws the viewer in for a closer inspection.  What is the story of this specimen?  What is the text on the side of the piece?  What is a DNA barcode?  Read on for answers to these and other questions.

About Mimoides clusoculis - by Daniel H. Janzen

The genus name says it all.  We learned this butterfly first as Papilio euryleon.  Then it became known as Eurytides euryleon.  And then it finally reached its current home as Mimoides clusoculis (formerly Mimoides euryleon clusoculis), as Papilio was subdivided into what is probably about as fine a taxonomic subdivision as will occur.  This is all in the spirit of the ever-present effort to have a genus be monophyletic (all members of the group be descended from one ancestor, and all those descended from that one ancestor be in this genus).   And why bother with this phylogenetic splitting of hairs?  In general terms, the more reliably monophyletic, the more accurate are likely to be predictions (inferences) about the (as yet) unknown biology (including morphology) of other members of the group.  Put in very simple terms, the Annonaceae-eating caterpillars of Mimoides clusoculis and Mimoides branchus (the former in upper Area de ConservaciĂłn Guanacaste (ACG) elevations, the latter in lower ACG elevations) do not share the same color pattern or morphology, and the color pattern of the adults can be easily attributed to mimicry of each other (rather than common ancestry), but the distinctive fat green pupae have very much in common, as does the wing venation.

But why the name Mimoides?  It is hard to walk for an hour along a rainy season ACG trail in insolated secondary succession without encountering a large black butterfly with white patches on the forewings and red patches on the hind wings.   It has a sufficiently fast wing beat such that the details of the white and the red are blurry, but the colors are obvious.  It pauses here and there on foliage, tasting for the chemicals that suggest a potential site to lay an egg.  It visits butterfly flowers, with the blue flowers of Stachytarpheta frantzi (Verbenaceae) very high on the list of favorites.  But who are you actually looking at?  There are at least 15 species of ACG mimetic Papilionidae with this behavior and color pattern (e.g., compare with Parides iphidamus). 

Many of these mimics are so similar that even the very best butterflyologists have to catch the specimen to know for certain which species it is.   Not all 15 visit the same flowers at the same time in the same ACG ecosystem, but since the birds circulate, this may not matter much.  And intermingled with them are look-alikes from other families, such as day-flying pericopid moths (e.g., Dysschema jansonis, Actiidae), pierids (e.g., Archoneas tereas) and a host of nymphalids with red to orange on the hind wings and white to yellow on the forewings.  The nymphalids do not match the textbook examples of quite exact mimetic resemblances of the papilionids, pericopids and pierids – and are generally ascribed to other mimetic complexes – but when in flight in bad light and to a not very mentally or visually discriminating bird, they certainly can easily be ascribed to the margins of the Mimoides mimetic color regime.  And who is mimicking who?  The classical center of this Mullerian and Batesian mimicry complex is Parides.  However, to know if there even is a center will require a lot more field experimentation with real predators in the wild.

Data and images about this species in the ACG can be explored in Google Fusion Tables.

Taken from Miller, J. C., Janzen, D. H. and Hallwachs, W. 2007.  100 Butterflies and moths.  Harvard University Press, Cambridge, Massachusetts.

About this piece – BOLD 12: Mimoides clusoculis by Joseph Rossano

If you look closely at the side of the encasement on this work of art, you’ll see a series of A’s, C’s, G’s and T’s.  They make up a DNA sequence, but not just any sequence – it’s a sequence unique to this species.  Each species has a different sequence at this particular spot in their DNA code.  Scientists call this sequence fragment a “DNA barcode”.  If each part of the sequence were represented by a different colour, it might look like:

DNA barcode schematic

What is a DNA barcode?

DNA barcoding uses a small fragment of a single gene in an organism’s DNA to identify the species to which that organism belongs, much like one might use a UPC barcode to distinguish different products.  These powerful tools are helping scientists to catalogue the world’s biodiversity.  The process began in Guelph, Ontario, Canada, and scientists here – like collaborator Dr. Paul Hebert of the Biodiversity Institute of Ontario (see below) – continue to lead international work aiming to catalogue the earth’s life forms completely.

More information:

DNA barcode of Mimoides clusoculis

MHMXY333-09|08-SRNP-35020|Mimoides clusoculis|COI-5P-acattatattttatttttggaatttgagcaggaatagttggaacttctc
taagattattaattcgtactgaattaggaaattctggatcattaattggagatgatcaaatttataatactatcgttactgctcatgcctttattataatttttttcatag
ttatacctattataattgggggatttggaaattgacttgtaccattaatattaggagctcctgatatagctttccctcgaataaataatataagattttgacttttacct
ccttcattaattcttttaatttctagaagaattgtagaaaatggggctggaacaggatgaacagtttatccccctctctcttctaatatcgcgcatagaggaagctca
gttgatttagctattttttctttacatttagctggaatttcctcaattttaggagcaattaactttattaccactattattaatatacgtgttaataatatatcatttgatcaa
atacctttatttgtatgagctgtgggaattacagctttacttttattactttcccttccagtattagcgggtgctattactatattattaactgatcgtaatttaaatacttct
ttttttgatccagctgggggaggagatccaattttatatcaacattta

Barcode courtesy of the International Barcode of Life (iBOL) project.

About the collaborators

Paul Hebert, PhD, a globally recognized pioneer of DNA Barcoding, is Canada Research Chair of Molecular Biodiversity and Director of the Canadian Centre for DNA Barcoding at the Biodiversity Institute, University of Guelph, Ontario, Canada.  He is also Principal Investigator on the International Barcode of Life (iBOL) project.  Click here for more information about Dr. Hebert's work.

Dan Janzen, PhD, is an evolutionary ecologist, naturalist, and conservationist, and Dimaura Professor of Conservation Biology at the University of Pennsylvania.  For 56 years he has spent much of his time doing field research in Costa Rica and since 1985 has been a founder and technical advisor to Area de ConservaciĂłn Guanacaste (ACG).  ACG, 2% of Costa Rica and the size of New York City and all its suburbs, is the oldest, largest and most successful tropical habitat restoration project in the world, located just south of the Costa Rica-Nicaragua border. Click here for more information about Dr. Janzen's efforts.

Ontario Genomics Institute (OGI) is a private, not-for-profit corporation based in Toronto, Ontario, Canada, focused on using world-class research to create strategic genomics resources and accelerate Ontario’s development of a globally-competitive life sciences sector.  Through its relationship with Genome Canada, the Ontario Ministry of Research and Innovation, and other private and public sector partners, OGI works to: identify, attract and support investment in Ontario-led genomics research; catalyze access to and the impact of genomics resources; and, raise the visibility of genomics as well as its impact and associated issues.  Click here to return to our home page and learn more about OGI.

What is the Area de ConservaciĂłn Guanacaste?

A UNESCO World Heritage Site since 1999, the Area de ConservaciĂłn Guanacaste (ACG) in Costa Rica is a vast protected ecosystem with an area of 120,000 terrestrial and 70,000 marine hectares.  The ACG contains important natural habitats for the conservation of biological diversity – approximately 230,000 species in total – including the best dry forest habitats from Central America to northern Mexico and key habitats for endangered or rare plant and animal species. The site demonstrates significant ecological processes in both its terrestrial and marine-coastal environments. (*modified from UNESCO)

The mission of the ACG is to conserve the biodiversity of the ecosystems and the cultural heritage present in the ACG, as a model of development which integrates society in the management of the Area. Learn more here.

For more information, click on these links of interest:

The art of Joseph Rossano
•    Joseph Rossano’s official site
•    Bill Lowe Gallery, Atlanta

DNA barcoding
•    Barcode of Life Data Systems
•    Canadian Centre for DNA Barcoding
•    International Barcode of Life (iBOL)

Biodiversity and conservation
•    Area Conservacion de Guanacaste (Costa Rica)

Data and images from the ACG caterpillar rearing inventory
•    Joe Rossano barcoded butterflies in Fusion Tables
•    Other ACG barcoded butterflies in Fusion Table blog
•    Janzen and Hallwachs caterpillar inventory database (*search for Mimoides clusoculis in the yellow box to the left)