BOLD 10 - Memphis mora

Image courtesy of the Barcode of Life Data Systems
A note from Joseph Rossano:
As an artist, I strive to distill ideas, concepts, and reality into their bare essence. My resulting minimalist sculptures, I hope, convey an emotion, ask a question, or direct the viewer on a path of introspection and investigation, as they explore man's impact on the environment. My series "BOLD" is named for the acronym for the Barcode of Life Data Systems database. The subject of each specimen box is neither real nor is it an accurate representation of the creature it is designed to represent; rather, it is a jeweled representation of reality that draws the viewer in for a closer inspection. What is the story of this specimen? What is the text on the side of the piece? What is a DNA barcode? Read on for answers to these and other questions.
About Memphis mora - by Dr. Dan Janzen
Memphis mora is a classical black-with-some-blue-iridescence charaxine, normally encountered by the butterflyologist when it has come to feed on fermenting bananas in a rain forest butterfly trap. There seem to be an overwhelming number of species of Memphis with this color pattern above, and below a gray-brown-rust bark-colored pattern. The males of Memphis tend to do the black and blue one way, and the females do the black and blue yet another way, with generally more blue than have the males. And it is commonplace for the females to have larger and longer tails on the hind wing, as in the Memphis mora.
But M. mora holds a special place in Area de Conservación Guanacaste (ACG) Memphis natural history. The ACG rain forest is densely populated with many tens of species of Lauraceae – Ocotea, Nectandra, Licaria, Beilschmedia, and Persea. And many of these are fed on by the caterpillars of various species of Memphis (and other charaxines as well). But M. mora feeds on only one of them – Ocotea cernua. It is one among many and to a human eye and taste has nothing special about it. But clearly it does to the other Lauraceae-feeding species of Memphis, because of 110 Memphis caterpillars found to date by the inventory on O. cernea, every single one has been M. mora, and as mentioned above, a M. mora caterpillar has never been found on any other species of food plant (despite the inventory having found more than 1000 wild Memphis caterpillars).
The male we portray has only a tiny bump on the margin of the hind wing. In ACG dry forest there is an absolute look-alike, Memphis boisduvali (= M. moruus, and not Memphis morvus as it is often written) which really can only be discriminated at a glance by having a several mm long tail where the bump is located on the M. mora wing. And just like its look-alike, M. boisduvali feeds on only one species of Lauraceae – but it is sort of cheating to make the comparison because the ACG dry forest has only one species of native Lauraceae, Ocotea veraguensis. However one wishes to categorize these two species, they are unambiguously extreme food plant specialists. Furthermore, not only are the adults extremely similar, but the caterpillars are almost identical as well – both species sporting the same red bar across their foreheads and yellow stripes on their faces. A single tail-less male of M. boisduvali was reared in Sector Santa Rosa, the ACG dry forest, but barcoding demonstrated fully that it was indeed a specimen of M. boisduvali (as the ecosystem indicates) rather than M. mora (as the appearance indicates).
Data and images about this species in the ACG can be explored in Google Fusion Tables.
Taken from Miller, J. C., Janzen, D. H. and Hallwachs, W. 2007. 100 Butterflies and moths. Harvard University Press, Cambridge, Massachusetts.
About this piece – BOLD 10: Memphis mora by Joseph Rossano
If you look closely at the side of the encasement on this work of art, you’ll see a series of A’s, C’s, G’s and T’s. They make up a DNA sequence, but not just any sequence – it’s a sequence unique to this species. Each species has a different sequence at this particular spot in their DNA code. Scientists call this sequence fragment a “DNA barcode”. If each part of the sequence were represented by a different colour, it might look like:
What is a DNA barcode?
DNA barcoding uses a small fragment of a single gene in an organism’s DNA to identify the species to which that organism belongs, much like one might use a UPC barcode to distinguish different products. These powerful tools are helping scientists to catalogue the world’s biodiversity. The process began in Guelph, Ontario, Canada, and scientists here – like collaborator Dr. Paul Hebert of the Biodiversity Institute of Ontario (see below) – continue to lead international work aiming to catalogue the earth’s life forms completely.
More information:
- View a video of Dr. Dan Janzen discussing DNA Barcoding.
- Learn more about using DNA barcoding to advance the discovery and identification of butterflies, moths, and skippers (i.e. Lepidoptera).
- Learn about the International Barcode of Life (iBOL) project, an Ontario-led worldwide effort to use DNA barcoding to identify all the species in the world.
DNA barcode of Memphis mora
MHACG645-05|03-SRNP-34653|Memphis mora|COI-5P-actttatattttatttttggaatttgagcaggaatagtaggaacttcattaag
tcttattatccgaactgaacttggtaatccaagatttttaattggtgatgaccaaatttataatactattgttacagctcatgcatttattataattttttttatagttatac
ccatcataattggaggatttggtaattgattaattcctttaatgcttggagcccctgatatagctttcccccgtataaataatataagattctgactcctccccccctcttta
attctcctaatttcaagcagaattgtagaaaatggagcaggaacaggatgaacagtctaccccccactatcatctaatattgctcacggaggatcatcagttgattt
agctattttttctttgcatttagcaggaatttcatcaattttaggagctattaattttattacaacaattattaatatgcgagtaaataatatatcttatgatcaaatacct
ttatttgtttgatctgtaggtattaccgctttacttttattactttctttaccagttttagctggagctattactatattattaactgatcgaaatttaaatacttcattttttgatc
cagctggaggaggtgatcctattctt
Barcode courtesy of the International Barcode of Life (iBOL) project.
About the collaborators
Paul Hebert, PhD, a globally recognized pioneer of DNA Barcoding, is Canada Research Chair of Molecular Biodiversity and Director of the Canadian Centre for DNA Barcoding at the Biodiversity Institute, University of Guelph, Ontario, Canada. He is also Principal Investigator on the International Barcode of Life (iBOL) project. Click here for more information about Dr. Hebert's work.
Dan Janzen, PhD, is an evolutionary ecologist, naturalist, and conservationist, and Dimaura Professor of Conservation Biology at the University of Pennsylvania. For 56 years he has spent much of his time doing field research in Costa Rica and since 1985 has been a founder and technical advisor to Area de ConservaciĂłn Guanacaste (ACG). ACG, 2% of Costa Rica and the size of New York City and all its suburbs, is the oldest, largest and most successful tropical habitat restoration project in the world, located just south of the Costa Rica-Nicaragua border. Click here for more information about Dr. Janzen's efforts.
Ontario Genomics Institute (OGI) is a private, not-for-profit corporation based in Toronto, Ontario, Canada, focused on using world-class research to create strategic genomics resources and accelerate Ontario’s development of a globally-competitive life sciences sector. Through its relationship with Genome Canada, the Ontario Ministry of Research and Innovation, and other private and public sector partners, OGI works to: identify, attract and support investment in Ontario-led genomics research; catalyze access to and the impact of genomics resources; and, raise the visibility of genomics as well as its impact and associated issues. Click here to return to our home page and learn more about OGI.
What is the Area de ConservaciĂłn Guanacaste?
A UNESCO World Heritage Site since 1999, the Area de Conservación Guanacaste (ACG) in Costa Rica is a vast protected ecosystem with an area of 120,000 terrestrial and 70,000 marine hectares. The ACG contains important natural habitats for the conservation of biological diversity – approximately 230,000 species in total – including the best dry forest habitats from Central America to northern Mexico and key habitats for endangered or rare plant and animal species. The site demonstrates significant ecological processes in both its terrestrial and marine-coastal environments. (*modified from UNESCO)
The mission of the ACG is to conserve the biodiversity of the ecosystems and the cultural heritage present in the ACG, as a model of development which integrates society in the management of the Area. Learn more here.
For more information, click on these links of interest:
The art of Joseph Rossano
• Joseph Rossano’s official site
• Bill Lowe Gallery, Atlanta
DNA barcoding
• Barcode of Life Data Systems
• Canadian Centre for DNA Barcoding
• International Barcode of Life (iBOL)
Biodiversity and conservation
• Area Conservacion de Guanacaste (Costa Rica)
Data and images from the ACG caterpillar rearing inventory
• Joe Rossano barcoded butterflies in Fusion Tables
• Other ACG barcoded butterflies in Fusion Table blog
• Janzen and Hallwachs caterpillar inventory database (*search for Memphis mora in the yellow box to the left)




