BOLD: The Art of DNA Barcoding

BOLD 1 - Zerene cesonia

Zerene cestonia

Image courtesy of the Barcode of Life Data Systems

A note from Joseph Rossano:

As an artist, I strive to distill ideas, concepts, and reality into their bare essence.  My resulting minimalist sculptures, I hope, convey an emotion, ask a question, or direct the viewer on a path of introspection and investigation, as they explore man's impact on the environment.  My series "BOLD" is named for the acronym for the Barcode of Life Data Systems database. The subject of each specimen box is neither real nor is it an accurate representation of the creature it is designed to represent; rather, it is a jeweled representation of reality that draws the viewer in for a closer inspection.  What is the story of this specimen?  What is the text on the side of the piece?  What is a DNA barcode?  Read on for answers to these and other questions.

About Zerene cesonia - by Daniel H. Janzen

I grew up in the outskirts of Minneapolis (before there were suburbs) in the early 1950’s.  I still remember my first caterpillar – a green thing feeding on the leaves of a shrubby legume in a glade in a city park (quite different from the aposematic monarch butterfly caterpillar reared by so many children).  Out of it came a fine yellow so-called “dog’s head” butterfly – Zerene cesonia.  Minneapolis is a long way from Costa Rica – ecologically, geographically, or even as the crow flies.  What we know is that Z. cesonia is not migrating back and forth as do monarchs, but rather that it is a steadily present denizen of the southern US, and its population creeps northward each summer, only to be blasted back by the blizzards each winter (see the gorgeous range map here; Z. cesonia is a breeding population scattered across the entire intervening landscape between Minnesota and Costa Rica, but on the dry side, where shrubby legumes are commonplace.  It may follow pastures into the Area de ConservaciĂłn Guanacaste (ACG) rain forest on occasion, but it needed humans to make the rain forest ecosystem habitable for it).  

The males of Z. cesonia all seem to be about one color and the one pattern that we figure, but as is commonplace among species of Pieridae, the females range from pale to dark yellow, and have a highly variable light to dark black pattern.  Don’t ask for speculation about the biological significance of the seeming eye spot on the top and under of the forewing – I suspect that it is not playing off the same predator avoidance as the false eye spots on forest caterpillars and pupae, and even the wings of many species of ACG Nymphalidae.   The spot does have, however, much in common with the same kind of spot on the wings of many other medium-sized pierids (other than the extreme mimic such as Dismorphia amphione).

Data and images about this species in the ACG can be explored in Google Fusion Tables.

Taken from Miller, J. C., Janzen, D. H. and Hallwachs, W. 2007.  100 Butterflies and moths.  Harvard University Press, Cambridge, Massachusetts.

About this piece – BOLD 1: Zerene cesonia by Joseph Rossano

If you look closely at the side of the encasement on this work of art, you’ll see a series of A’s, C’s, G’s and T’s.  They make up a DNA sequence, but not just any sequence – it’s a sequence unique to this species.  Each species has a different sequence at this particular spot in their DNA code.  Scientists call this sequence fragment a “DNA barcode”.  If each part of the sequence were represented by a different colour, it might look like:

DNA barcode schematic

What is a DNA barcode?

DNA barcoding uses a small fragment of a single gene in an organism’s DNA to identify the species to which that organism belongs, much like one might use a UPC barcode to distinguish different products.  These powerful tools are helping scientists to catalogue the world’s biodiversity.  The process began in Guelph, Ontario, Canada, and scientists here – like collaborator Dr. Paul Hebert of the Biodiversity Institute of Ontario (see below) – continue to lead international work aiming to catalogue the earth’s life forms completely.

More information:

DNA barcode of Zerene cesonia

MHMXO509-08|07-SRNP-57889|Zerene cesonia|COI-5P-actttatattttatttttggtgtttgagcagggataattggaacttcattaa
gattattaattcgtacagaattaggtaatccaggttcattaattggagatgatcaaatttataacacaattgtaacagctcatgcttttatcataattttttttatag
ttatacctattataattggaggatttggaaattgattagtccctttaatattaggagcacctgatatagcattcccacgtataaataatataagattttgattgctt
cccccttcattaacgttattaatttctagaagtattgttgaaaacggagcaggaacaggatgaactgtatatcccccattatcctctaatattgctcatagaggag
catcagttgatttagctattttttcattacaccttgctggaatttcatctattcttggagctattaattttattacaacaattatcaatatacgtattaataatatatctttt
gatcaaatacctttatttgtttgagcagtaggaattactgctttattacttttactatctttaccagttttagctggtgctattactatattattaacagatcggaactta
aatacatcattttttgaccctgcaggagggggagatcctattctttaccaacatttattt

Barcode courtesy of the International Barcode of Life (iBOL) project.

About the collaborators

Paul Hebert, PhD, a globally recognized pioneer of DNA Barcoding, is Canada Research Chair of Molecular Biodiversity and Director of the Canadian Centre for DNA Barcoding at the Biodiversity Institute, University of Guelph, Ontario, Canada.  He is also Principal Investigator on the International Barcode of Life (iBOL) project.  Click here for more information about Dr. Hebert's work.

Dan Janzen, PhD, is an evolutionary ecologist, naturalist, and conservationist, and Dimaura Professor of Conservation Biology at the University of Pennsylvania.  For 56 years he has spent much of his time doing field research in Costa Rica and since 1985 has been a founder and technical advisor to Area de ConservaciĂłn Guanacaste (ACG).  ACG, 2% of Costa Rica and the size of New York City and all its suburbs, is the oldest, largest and most successful tropical habitat restoration project in the world, located just south of the Costa Rica-Nicaragua border. Click here for more information about Dr. Janzen's efforts.

Ontario Genomics Institute (OGI) is a private, not-for-profit corporation based in Toronto, Ontario, Canada, focused on using world-class research to create strategic genomics resources and accelerate Ontario’s development of a globally-competitive life sciences sector.  Through its relationship with Genome Canada, the Ontario Ministry of Research and Innovation, and other private and public sector partners, OGI works to: identify, attract and support investment in Ontario-led genomics research; catalyze access to and the impact of genomics resources; and, raise the visibility of genomics as well as its impact and associated issues.  Click here to return to our home page and learn more about OGI.

What is the Area de ConservaciĂłn Guanacaste?

A UNESCO World Heritage Site since 1999, the Area de ConservaciĂłn Guanacaste (ACG) in Costa Rica is a vast protected ecosystem with an area of 120,000 terrestrial and 70,000 marine hectares.  The ACG contains important natural habitats for the conservation of biological diversity – approximately 230,000 species in total – including the best dry forest habitats from Central America to northern Mexico and key habitats for endangered or rare plant and animal species. The site demonstrates significant ecological processes in both its terrestrial and marine-coastal environments. (*modified from UNESCO)

The mission of the ACG is to conserve the biodiversity of the ecosystems and the cultural heritage present in the ACG, as a model of development which integrates society in the management of the Area. Learn more here.

For more information, click on these links of interest:

The art of Joseph Rossano
•    Joseph Rossano’s official site
DNA barcoding
•    Barcode of Life Data Systems
•    Canadian Centre for DNA Barcoding
•    International Barcode of Life (iBOL)

Biodiversity and conservation
•    Area Conservacion de Guanacaste (Costa Rica)

Data and images from the ACG caterpillar rearing inventory
•    Joe Rossano barcoded butterflies in Fusion Tables
•    Other ACG barcoded butterflies in Fusion Table blog
•    Janzen and Hallwachs caterpillar inventory database (*search for Zerene cesonia in the yellow box to the left)